Phenotypic Mutation 'Yosemite'

• Allele: Yosemite
• Mutation Type: critical splice donor site (1 bp from exon)
• Chromosome: 7
• Coordinate: 30,568,934 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Cd22
• Gene Name: CD22 antigen
• Synonym(s): Lyb8, Lyb-8
• Chromosomal Location: 30,564,829-30,579,767 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000019248 ^†] [ENSMUSP00000103760 ^†] [ENSMUSP00000139685 ^†] [ENSMUSP00000141178 ^†] [ENSMUSP00000140521 ^†] [ENSMUSP00000140528 ^†] [ENSMUSP00000139871 ^†] [ENSMUSP00000150025 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000019248; Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000103760; Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000139685; Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably null
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000140521; Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably null
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000140528; Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	1.1e-3	SMART
IG_like	166	245	1.6e-2	SMART
IGc2	269	337	1.1e-6	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000139871; Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9587
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• MMRRC Submission: 038179-MU
• Last Updated: 2019-09-04 9:46 PM by Diantha La Vine
• Record Created: 2015-03-04 10:50 AM by Anne Murray
• Record Posted: 2015-03-31
• Science Writers: Anne Murray
• Illustrators: Peter Jurek

Accession Number

NCBI RefSeq: NM_001043317.2, NM_009845.3; MGI: 88322

Alleles Listed at MGI

All mutations/alleles(16) : Chemically induced (ENU)(3) Targeted(13)

Phenotypic Description

Figure 1. Yosemite mice exhibit a reduced frequency of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine the frequency of B cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Yosemite mice exhibit an increased frequency of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine the frequency of B1a cells in B1 cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Yosemite mice exhibit a decreased frequency of peripheral IgM + B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM + B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Yosemite mice exhibit a decreased percentage of peripheral IgD + B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD + B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The yosemite phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0926, some of which showed a decrease in the frequency of B cells (Figure 1), an increased frequency of B1a cells in B1 cells (Figure 2), a reduced frequency of IgM⁺ B cells (Figure 3), a decrease in the percentage of IgD⁺ B cells (Figure 4), all in the peripheral blood.

Nature of Mutation

Figure 5. Linkage mapping of the reduced peripheral B1a in B1 cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R0926. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Cd22:  a G to T transversion at base pair 30,869,509 (v38) on chromosome 7, or base pair 10,834 in the GenBank genomic region NC_000073 within the donor splice site of intron 9. The strongest association was found with an additive model of linkage to the normalized frequency of peripheral B1a cells in B1 cells, wherein 1 variant homozygote and 14 heterozygotes departed phenotypically from 10 homozygous reference mice with a P value of 3.57 x 10^-4 (Figure 5).  A substantial semidominant effect was observed in the B1a assay, but the mutation is preponderantly recessive; in no assay was a purely dominant effect observed. The mutation is predicted to result in an in-frame skipping of the 264-nucleotide exon 9 (out of 14 total exons), which encodes amino acids 612-699. The effect of the mutation at the cDNA and protein level has not been tested.

<--exon 8      <--exon 9 intron 9-->    exon 10-->           <--exon 14 10473 ……CTCCAAGTGCTGT……CTCACTGTCTACT gtaagttcccctt……ACAGTCCAGAGACC……ACCCTCAAGCACTGA 607   ……-L--Q--V--L--……-L--T--V--Y--                Y--S--P--E--T-……-T--L--K--H--*-           correct         deleted                               correct

Genomic numbering corresponds to NC_000073. The donor splice site of intron 9, which is destroyed by the yosemite mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 6. Domain structure of CD22. The Yosemite mutation is within the donor splice site of intron 9. Abbreviations: SP, signaling peptide; TM, transmembrane domain; ITIM, immunoreceptor tyrosine-based inhibitory motif.

CD22 belongs to the Siglec (sialic acid-binding) family of adhesion molecules (1;2) (Figure 6). Siglecs are members of the immunoglobulin (Ig) superfamily, which specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates. Siglec proteins are type 1 transmembrane proteins with a sialic acid-binding N-terminal Ig-like V-type domain, variable numbers of Ig-like C2-type domains, a transmembrane region, and a cytoplasmic tail.  CD22 contains seven immunoglobulin domains in its extracellular region at amino acids 31-147, 156-254, 269-337, 365-424,448-523, 541-599, and 628-687 (1).  The yosemite mutation is predicted to result in the deletion of amino acids 612-699 the seventh immunoglobulin domain.

See the record well for more information about Cd22.

Putative Mechanism

CD22 is one of two Siglecs expressed by B cells (the other being Siglec-G), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed in (3;4)].  CD22 associates with a number of BCR signaling molecules including the BCR complex itself.  Upon cross-linking of the BCR by antigen, associated CD22 is rapidly phosphorylated by Lyn (5-7).  The subsequent association of SHP1 with CD22 leads to the dephosphorylation of a number of BCR signaling components that dampens the BCR signal and Ca²⁺ mobilization such as Vav-1, CD19 and BLNK (8-10). In response to BCR stimulation, CD22-deficient B cells predominantly undergo apoptosis (11).  Although CD22 appears to be dispensable for the differentiation of B cells to mature follicular cells, CD22-deficient B cells express less surface IgM, which may be a consequence of a faster and more complete maturation process. In addition, CD22-deficient mice have severely reduced numbers of marginal zone B (MZB) cells, and increased numbers of B-1 peritoneal cells was observed in two of the four knockout strains (12-15). The loss of MZB cells and increased B-1 cell numbers in these mice may be due to altered BCR signaling during development as maturation into the three mature B cell subsets is driven in part by differences in BCR signal strength, and a strong BCR signal disrupts MZB development and promotes B-1 differentiation [reviewed by (16;17)]. Due to the lack of MZB cells, these animals display impaired immune responses to T-independent antigens (12;15;18), while T-dependent immune responses remain intact and subsequent germinal center formation occurs normally (11). Mice carrying the yosemite allele share several phenotypes with the Cd22 knockout mice including defects in peripheral B cell maturation that are likely caused by reduced MZB cell numbers. A defect in immune responses to T-dependent or T-independent antigens was not observed in the yosemite mice indicating that some residual CD22 function may occur in the yosemite mice.

Primers

PCR Primer
Yosemite_pcr_F: ATCCATCAAGGGCGAGATTGGC
Yosemite_pcr_R: AACCTCCAAGTGCTGTGTGAGTG

Sequencing Primer
Yosemite_seq_F: GGGCGAGATTGGCATGTAG
Yosemite_seq_R: CTGTGAGAGTGATGCCAATCC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 540 nucleotides is amplified (chromosome 7, - strand):

1   aacctccaag tgctgtgtga gtggctggag ctggggccta aatgagaaga tgatgaggtg
61  acccgctgcc ccggcctgac tcggggtctc ctttacagat gctcctcgga ggctgcgtgt
121 gtccatcagc cctggggacc atgtgatgga ggggaagaag gccaccttgt cctgtgagag
181 tgatgccaat ccgcccatct cacagtacac ctggtttgac tccagtggcc aagacctcca
241 ctcctcaggc cagaaactga gactggaacc cctggaggtc caacacacgg gttcctaccg
301 ctgcaaaggg accaatggga taggcacagg agagtcacca cccagcaccc tcactgtcta
361 ctgtaagttc cccttgctgt cttcccttgg tccctgtcct gtcctgggag ctgcagtccc
421 ttccctcttc cttctcctgt gtctagctca gacataccct gtgacctgag tggaaagtcc
481 cctgctcttc cggcctgcct tcctcctttc ttctacatgc caatctcgcc cttgatggat 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Torres, R. M., Law, C. L., Santos-Argumedo, L., Kirkham, P. A., Grabstein, K., Parkhouse, R. M., and Clark, E. A. (1992) Identification and Characterization of the Murine Homologue of CD22, a B Lymphocyte-Restricted Adhesion Molecule. J Immunol. 149, 2641-2649.

  2. Wilson, G. L., Fox, C. H., Fauci, A. S., and Kehrl, J. H. (1991) CDNA Cloning of the B Cell Membrane Protein CD22: A Mediator of B-B Cell Interactions. J Exp Med. 173, 137-146.

  3. Walker, J. A., and Smith, K. G. (2008) CD22: An Inhibitory Enigma. Immunology. 123, 314-325.

  4. Nitschke, L. (2009) CD22 and Siglec-G: B-Cell Inhibitory Receptors with Distinct Functions. Immunol Rev. 230, 128-143.

  5. Leprince, C., Draves, K. E., Geahlen, R. L., Ledbetter, J. A., and Clark, E. A. (1993) CD22 Associates with the Human Surface IgM-B-Cell Antigen Receptor Complex. Proc Natl Acad Sci U S A. 90, 3236-3240.

  6. Smith, K. G., Tarlinton, D. M., Doody, G. M., Hibbs, M. L., and Fearon, D. T. (1998) Inhibition of the B Cell by CD22: A Requirement for Lyn. J Exp Med. 187, 807-811.

  7. Schulte, R. J., Campbell, M. A., Fischer, W. H., and Sefton, B. M. (1992) Tyrosine Phosphorylation of CD22 during B Cell Activation. Science. 258, 1001-1004.

  8. Gerlach, J., Ghosh, S., Jumaa, H., Reth, M., Wienands, J., Chan, A. C., and Nitschke, L. (2003) B Cell Defects in SLP65/BLNK-Deficient Mice can be Partially Corrected by the Absence of CD22, an Inhibitory Coreceptor for BCR Signaling. Eur J Immunol. 33, 3418-3426.

  9. Sato, S., Jansen, P. J., and Tedder, T. F. (1997) CD19 and CD22 Expression Reciprocally Regulates Tyrosine Phosphorylation of Vav Protein during B Lymphocyte Signaling. Proc Natl Acad Sci U S A. 94, 13158-13162.

  10. Fujimoto, M., Bradney, A. P., Poe, J. C., Steeber, D. A., and Tedder, T. F. (1999) Modulation of B Lymphocyte Antigen Receptor Signal Transduction by a CD19/CD22 Regulatory Loop. Immunity. 11, 191-200.

  11. Poe, J. C., Fujimoto, Y., Hasegawa, M., Haas, K. M., Miller, A. S., Sanford, I. G., Bock, C. B., Fujimoto, M., and Tedder, T. F. (2004) CD22 Regulates B Lymphocyte Function in Vivo through both Ligand-Dependent and Ligand-Independent Mechanisms. Nat Immunol. 5, 1078-1087.

  12. Otipoby, K. L., Andersson, K. B., Draves, K. E., Klaus, S. J., Farr, A. G., Kerner, J. D., Perlmutter, R. M., Law, C. L., and Clark, E. A. (1996) CD22 Regulates Thymus-Independent Responses and the Lifespan of B Cells. Nature. 384, 634-637.

  13. Sato, S., Miller, A. S., Inaoki, M., Bock, C. B., Jansen, P. J., Tang, M. L., and Tedder, T. F. (1996) CD22 is both a Positive and Negative Regulator of B Lymphocyte Antigen Receptor Signal Transduction: Altered Signaling in CD22-Deficient Mice. Immunity. 5, 551-562.

  14. O'Keefe, T. L., Williams, G. T., Davies, S. L., and Neuberger, M. S. (1996) Hyperresponsive B Cells in CD22-Deficient Mice. Science. 274, 798-801.

  15. Nitschke, L., Carsetti, R., Ocker, B., Kohler, G., and Lamers, M. C. (1997) CD22 is a Negative Regulator of B-Cell Receptor Signalling. Curr Biol. 7, 133-143.

  16. Niiro, H., and Clark, E. A. (2002) Regulation of B-Cell Fate by Antigen-Receptor Signals. Nat Rev Immunol. 2, 945-956.

  17. Pillai, S., Cariappa, A., and Moran, S. T. (2005) Marginal Zone B Cells. Annu Rev Immunol. 23, 161-196.

  18. Samardzic, T., Marinkovic, D., Danzer, C. P., Gerlach, J., Nitschke, L., and Wirth, T. (2002) Reduction of Marginal Zone B Cells in CD22-Deficient Mice. Eur J Immunol. 32, 561-567.