Phenotypic Mutation 'crawler' (pdf version)
List |< first << previous [record 88 of 511] next >> last >|
Allelecrawler
Mutation Type nonsense
Chromosome6
Coordinate64,429,694 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Grid2
Gene Name glutamate receptor, ionotropic, delta 2
Synonym(s) GluRdelta2, tpr, B230104L07Rik
Chromosomal Location 63,255,876-64,668,282 bp (+)
MGI Phenotype Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm.
Accession Number

NCBI RefSeq: NM_008167; MGI: 95813

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000093536]
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: Y679*

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category behavior/neurological, growth/size, nervous system
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(34) : Chemically induced (ENU)(2) Gene trapped(2) Spontaneous(22) Targeted(6) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.89
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense probably benign 0.26
IGL02064:Grid2 APN 6 64063935 missense probably damaging 0.98
IGL02216:Grid2 APN 6 64345666 missense possibly damaging 0.67
IGL02563:Grid2 APN 6 64345873 missense probably damaging 0.96
IGL02685:Grid2 APN 6 64345816 missense probably benign 0.30
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.96
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.91
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.72
swagger UTSW 6 64395280 nonsense
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign 0.00
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1598:Grid2 UTSW 6 64663410 splice donor site probably benign
R1619:Grid2 UTSW 6 64094448 splice donor site probably benign
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R1969:Grid2 UTSW 6 64320207 splice donor site probably benign
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4033:Grid2 UTSW 6 64180188 missense probably benign 0.30
R4124:Grid2 UTSW 6 63503433 nonsense probably null
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 nonsense probably null
R5534:Grid2 UTSW 6 63503361 nonsense probably null
R5626:Grid2 UTSW 6 64076945 unclassified probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, gDNA
MMRRC Submission 038228-MU
Last Updated 05/25/2017 3:34 PM by Katherine Timer
Record Created 03/10/2015 7:11 PM by Jeff SoRelle
Record Posted 12/01/2016
Phenotypic Description

Figure 1. Phenotype of the crawler mice.

The crawler phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1572, some of which exhibited ataxia and an abnormal gait (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 120 mutations. Among these the mutation in Grid2 was presumed to be causative because the crawler neurological phenotype mimics other known alleles of Grid2 (see MGI for a list of Grid2 alleles). The mutation in Grid2 is a T to A transversion at base pair 64,429,694 (v38) on chromosome 6, or base pair 1,173,792 in the GenBank genomic region NC_000072 encoding Grid2. The mutation corresponds to residue 2,037 in the NM_008167 mRNA sequence in exon 13 of 16 total exons. 

 

2020 CAAACAGATATCCCTTATGGCACAGTCTTGGAC

674  -Q--T--D--I--P--Y--G--T--V--L--D-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 679 for a premature stop codon (Y679*) in the GluRδ2 protein.

Protein Prediction

Figure 2. Domain organization (top) and membrane topography of GluRδ2 (bottom). The domains are labeled as explained in the text. The crawler mutation results in substitution of tyrosine 679 for a premature stop codon (Y679*). The SYTANLAAF sequence motif in the M3 transmembrane helix is indicated, with the alanine mutated in Lurcher mice and the tyrosine mutated in swagger mice indicated. The ligand binding pocket formed by the two lobes D1 and D2 is shown as filled with either glycine or D-serine, which have been shown to bind to GluRδ2 with low affinity. Not to scale.

Glutamate receptor ion channels (ionotropic glutamate receptors, iGluR), which are nonselective for monovalent cations (and sometimes Ca2+ permeable), are the major mediators of excitatory synaptic transmission in the central nervous system. iGluRs are tetramers arranged as a dimer of dimers (1-3). Each subunit has a characteristic modular architecture with four domains: the N-terminal domain (NTD), the ligand- or agonist-binding domain (LBD), the transmembrane region, and the C-terminal domain (CTD) (Figure 2) [reviewed in (4;5)]. The extracellular NTD mediates dimer formation and controls heteromer formation among members of the same iGluR subfamily (6). The extracellular LBD is encoded by two polypeptide segments, S1 and S2, which are separated by amino acids that make up part of the transmembrane portion of the protein. The CTD is important for proper delivery of the receptor to the membrane (7;8), for clustering the receptor at the PSD (9;10), and for maintaining stable localization of the receptor at the PSD (11). The transmembrane regions of iGluRs form the ion channel pore, and consist of three α-helices (M1, M3, and M4) and a membrane-inserted pore loop (P or M2).

 

The crawler mutation occurs within the S2 segment, and converts tyrosine 679 to a stop codon.

 

For more information about Grid2, please see the record for swagger.

Putative Mechanism

Glutamate is synthesized, stored, released from the presynaptic terminal, and acts through both ligand-gated ion channels (ionotropic glutamate receptors) and G-protein coupled receptors (metabotropic glutamate receptors) on postsynaptic neurons. Activation of these receptors accounts for basal excitatory synaptic transmission and synaptic plasticity, such as long-term potentiation (LTP) and long-term depression (LTD) that are thought to underlie learning and memory. 

 

Lurcher mice have an alanine to threonine point mutation at residue 654 in GluRδ2. Lurcher heterozygotes are smaller than normal at maturity, but are fertile and have a normal lifespan. Lc/+ mice show a swaying of the hindquarters, a jerky up and down movement, and a tendency to fall in their attempts to walk, which are visible by 12 to 14 days of age (12;13). Walking also involves exaggerated hindlimb flexion. GluRδ2-deficient mice display impaired motor coordination, with ataxia observable by postnatal day 12 (14). These mice walk with tottering steps, and lose balance and roll when they rear up on their hind legs. 

 

The phenotype of crawler mice resembles those of Grid2-/- mice, as well as heterozygous Lurcher mice. Although protein expression of GluRδ2 has not been examined, two reasons suggest that the crawler mutation results effectively in a protein null phenotype rather than a gain-of-function phenotype causing massive Purkinje cell death such as that observed in Lurcher mice. First, the mutation creates a premature stop codon, which is likely to disrupt protein stability and lead to degradation. Second, like the Grid2 null allele and the hotfoot alleles (mainly deletions of portions of the CTD), the crawler mutation is recessive. In contrast, the Lurcher mutation causes death when present in homozygous form. 

Primers PCR Primer
crawler(F):5'- TGTCACCAAGGGAGATGTATGAACAAC -3'
crawler(R):5'- TGCCTGCTTGGGACTCCAAAAC -3'

Sequencing Primer
crawler_seq(F):5'- GAACTTAGAGGCAGTCCTCCTTAG -3'
crawler_seq(R):5'- GGGACTCCAAAACATTGTTTTCTG -3'
References
  12. Phillips, R. (1960) 'Lurcher', a New Gene in Linkage Group XI of the House Mouse. J Genet. 57, 35-42.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle and Bruce Beutler
List |< first << previous [record 88 of 511] next >> last >|