Phenotypic Mutation 'chubby' (pdf version)
List |< first << previous [record 71 of 511] next >> last >|
Allelechubby
Mutation Type missense
Chromosome18
Coordinate66,859,847 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Mc4r
Gene Name melanocortin 4 receptor
Synonym(s) Fatboy
Chromosomal Location 66,857,715-66,860,472 bp (-)
MGI Phenotype Mutations in this gene result in hyperglycemia and weight gain.
Accession Number
NCBI RefSeq: NM_016977; MGI: 99457
Mapped Yes 
Amino Acid Change Valine changed to Glutamic Acid
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: V65E

DomainStartEndE-ValueType
Pfam:7tm_4 51 228 8.1e-11 PFAM
Pfam:7TM_GPCR_Srsx 55 317 6e-12 PFAM
Pfam:7tm_1 61 302 2.7e-31 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000057942)
Phenotypic Category adipose tissue, growth/size
Penetrance  
Alleles Listed at MGI

All mutations/alleles(11) : Chemically induced (ENU)(4) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66859158 missense probably benign 0.00
IGL01382:Mc4r APN 18 66859793 missense probably damaging 0.99
IGL01820:Mc4r APN 18 66859155 missense probably benign 0.00
IGL02749:Mc4r APN 18 66859662 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66859247 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66859526 missense probably benign 0.06
Big_boned UTSW 18 66859488 missense probably damaging 1.00
halloween UTSW 18 66859821 missense probably damaging 1.00
Southbeach UTSW 18 66859142 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66859695 missense probably benign 0.00
R1623:Mc4r UTSW 18 66859997 missense probably benign 0.03
R1666:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66859460 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66859598 missense probably damaging 1.00
R2210:Mc4r UTSW 18 66859395 missense probably damaging 1.00
R3714:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66859979 missense probably benign 0.00
R4322:Mc4r UTSW 18 66859050 missense probably benign 0.00
R4492:Mc4r UTSW 18 66859640 missense probably benign 0.00
R4806:Mc4r UTSW 18 66859488 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66859338 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission
Last Updated 09/20/2016 11:36 AM by Katherine Timer
Record Created 03/10/2015 7:51 PM by Jeff SoRelle
Record Posted 03/16/2015
Phenotypic Description

Figure 1. Homozygous chubby mice exhibited increased body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The chubby phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1781, some of which showed higher body weights than wild-type and heterozygous littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 97 mutations (X-axis) identified in the G1 male of pedigree R1781. Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 97 mutations. The increased body weight phenotype was linked to a mutation in Mc4r:  a T to A transversion at base pair 66,859,847 (v38) on chromosome 18, or base pair 641 in the GenBank genomic region NC_000084 encoding Mc4r.  Linkage was found with a recessive model of inheritance (P = 1.101 x 10-8), wherein 1 variant homozygote departed phenotypically from 5 homozygous reference mice and 8 heterozygous mice (Figure 2). The mutation corresponds to residue 641 in the mRNA sequence NM_016977 within exon 1 of 1 total exons. The obesity phenotype observed in chubby mice mirrored that of other ENU-induced mutations attributed to Mc4r, including Southbeach and Fatboy (MGI:2671841) [Figure 3; (1)], confirming that the Mc4r mutation in chubby was causative.

 

625 TTGGAGAACATTCTAGTGATCGTGGCGATAGCC

60  -L--E--N--I--L--V--I--V--A--I--A-

 

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to glutamic acid (E) substitution at position 65 (V65E) in the MC4R protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.999).

Protein Prediction

Figure 3. Domain structure and topography of mouse MC4R. The locations of the transmembrane (TM) domains are indicated. The chubby mutation causes a conversion of valine to glutamic acid at residue 65 of the MC4R protein. The image is interactive; click to view other MC4R mutations.

Figure 4. 3D model of Melanocortin-4 receptor. The locations of the Big_bonedchubby, Southbeach, and halloween mutations are indicated. UCSF Chimera model is based on PDB:2IQR. Click on the 3D structure to view it rotate.

MC4R belongs to the family of melanocortin receptors, which are seven transmembrane (TM) spanning G-protein coupled receptors (GPCRs) (Figure 3 & 4). MC4R activates the heterotrimeric G-protein Gs, which stimulates adenylyl cyclase production of cAMP from ATP (2). Based on a pure modeling approach modeled upon the crystal structure of bovine rhodopsin, another GPCR, residues in transmembrane domain (TM)3, TM4, TM5 and TM6 were predicted to flank the ligand binding site. Extracellular loops 2 and 3 also participate in docking of ligand (3). Interestingly, TM1 and TM7 were not predicted to contribute to ligand binding, although F284 was found at the edge of the ligand-binding pocket (3). The third intracellular loop of MC4R is predicted to form an α-helical segment, and play an important role in coupling the receptor to Gs. The chubby mutation causes a valine to glutamic acid substitution at amino acid 65 within TM1.

 

Please see the record for Southbeach for more information about Mc4r.

Putative Mechanism

A main mechanism of energy balance regulation involves the control of signaling by the central melanocortin receptors (MCRs) MC3R and MC4R within a defined hypothalamic neural network. Two sets of neurons in the arcuate nucleus (a region surrounding the third ventricle in the most ventral portion of the hypothalamus) act as sensors of whole-body energy status and initiate signals to maintain energy stores at a constant level. The Agrp/Npy neurons (producing Agrp and neuropeptide Y) are inhibited by the leptin peptide (see the record for Potbelly) by signaling through the leptin receptor (see the record for Business_class), while Pomc/Cart neurons (producing Pomc; its proteolytic products and cocaine- and amphetamine-regulated transcript) are stimulated by leptin (4-6). Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons (4;7). Thus, when leptin levels are low, Agrp/Npy neurons are activated and Pomc/Cart neurons are inhibited, producing Agrp but not Pomc, and resulting in inhibition of MC4R and increased food intake. In humans, mutations in MC4R are associated with obesity (OMIM #601665). Human patients with MC4R mutations exhibit increased body mass index, increased appetite, increased height, increased lean mass, increased bone mineral density and hyperinsulinemia (8). With the exception of increased bone mineral density, these phenotypes are recapitulated in Mc4r null mice (9). The localization, expression, and function of the MC4Rchubby protein have not been determined; however, the obesity phenotype of the chubby mice indicates that the mutation results in loss of MC4R function.

Primers PCR Primer
chubby(F):5'- TGCGAGCAAGGAGCTACAGATCAC -3'
chubby(R):5'- ACCCAGGAGGTTGGATCAGTTCAAG -3'

Sequencing Primer
chubby_seq(F):5'- AGCTACAGATCACAGAGTCAATG -3'
chubby_seq(R):5'- TCAGTTCAAGGAGGACTCAAATC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Jianhui Wang
List |< first << previous [record 71 of 511] next >> last >|