Phenotypic Mutation 'chubby' (pdf version)
Allelechubby
Mutation Type missense
Chromosome18
Coordinate66,992,918 bp (GRCm39)
Base Change A ⇒ T (forward strand)
Gene Mc4r
Gene Name melanocortin 4 receptor
Synonym(s) Pkcp, Fatboy
Chromosomal Location 66,990,776-66,993,558 bp (-) (GRCm39)
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
Accession Number
NCBI RefSeq: NM_016977; MGI: 99457
MappedYes 
Amino Acid Change Valine changed to Glutamic Acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000054776]
AlphaFold P56450
SMART Domains Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: V65E

DomainStartEndE-ValueType
Pfam:7tm_4 51 228 8.1e-11 PFAM
Pfam:7TM_GPCR_Srsx 55 317 6e-12 PFAM
Pfam:7tm_1 61 302 2.7e-31 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000057942)
Meta Mutation Damage Score 0.9242 question?
Is this an essential gene? Probably nonessential (E-score: 0.093) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(11) : Chemically induced (ENU)(4) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66992229 missense probably benign 0.01
IGL01382:Mc4r APN 18 66992864 missense probably damaging 0.96
IGL01820:Mc4r APN 18 66992226 missense probably benign 0.00
IGL02749:Mc4r APN 18 66992733 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66992318 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66992597 missense possibly damaging 0.61
Big_boned UTSW 18 66992559 missense probably damaging 1.00
Big_mac UTSW 18 66992927 missense probably damaging 1.00
blubbery UTSW 18 66992253 missense probably damaging 1.00
Cetacean UTSW 18 66992251 nonsense probably null
halloween UTSW 18 66992892 missense probably damaging 1.00
Leviathan UTSW 18 66993110 start codon destroyed probably null 0.49
southbeach UTSW 18 66992213 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66992766 missense probably benign 0.00
R1623:Mc4r UTSW 18 66993068 missense probably benign 0.03
R1666:Mc4r UTSW 18 66992480 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66992480 missense probably damaging 1.00
R1781:Mc4r UTSW 18 66992918 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66992531 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66992669 missense probably damaging 1.00
R2210:Mc4r UTSW 18 66992466 missense probably damaging 1.00
R3714:Mc4r UTSW 18 66992892 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66992892 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66993050 missense probably benign
R4322:Mc4r UTSW 18 66992121 missense probably benign 0.00
R4492:Mc4r UTSW 18 66992711 missense probably benign 0.00
R4806:Mc4r UTSW 18 66992559 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66992409 missense probably benign 0.00
R6161:Mc4r UTSW 18 66992251 nonsense probably null
R6802:Mc4r UTSW 18 66992488 missense probably benign 0.21
R6807:Mc4r UTSW 18 66992927 missense probably damaging 1.00
R6929:Mc4r UTSW 18 66992253 missense probably damaging 1.00
R7623:Mc4r UTSW 18 66992580 missense probably benign 0.32
R8292:Mc4r UTSW 18 66993082 nonsense probably null
R8560:Mc4r UTSW 18 66992166 missense possibly damaging 0.60
R8897:Mc4r UTSW 18 66992304 missense probably damaging 0.99
R8943:Mc4r UTSW 18 66993110 start codon destroyed probably null 0.49
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 038174-MU
Last Updated 2019-09-04 9:46 PM by Diantha La Vine
Record Created 2015-03-10 7:51 PM by Jeff SoRelle
Record Posted 2015-03-16
Phenotypic Description

Figure 1. Homozygous chubby mice exhibited increased body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The chubby phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1781, some of which showed higher body weights than wild-type and heterozygous littermates (Figure 1).
Nature of Mutation

Figure 2. Linkage mapping of the increased body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 97 mutations (X-axis) identified in the G1 male of pedigree R1781. Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 97 mutations. The increased body weight phenotype was linked to a mutation in Mc4r:  a T to A transversion at base pair 66,859,847 (v38) on chromosome 18, or base pair 641 in the GenBank genomic region NC_000084 encoding Mc4r.  Linkage was found with a recessive model of inheritance (P = 1.101 x 10-8), wherein 1 variant homozygote departed phenotypically from 5 homozygous reference mice and 8 heterozygous mice (Figure 2). The mutation corresponds to residue 641 in the mRNA sequence NM_016977 within exon 1 of 1 total exons. The obesity phenotype observed in chubby mice mirrored that of other ENU-induced mutations attributed to Mc4r, including Southbeach and Fatboy (MGI:2671841) [Figure 3; (1)], confirming that the Mc4r mutation in chubby was causative.

625 TTGGAGAACATTCTAGTGATCGTGGCGATAGCC

60  -L--E--N--I--L--V--I--V--A--I--A-

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to glutamic acid (E) substitution at position 65 (V65E) in the MC4R protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.999).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain structure and topography of mouse MC4R. The locations of the transmembrane (TM) domains are indicated. The chubby mutation causes a conversion of valine to glutamic acid at residue 65 of the MC4R protein. The image is interactive; click to view other MC4R mutations.

Figure 4. 3D model of Melanocortin-4 receptor. The locations of the Big_boned, Cetacean, chubby, halloween, and Southbeach mutations are indicated. UCSF Chimera model is based on PDB 2IQR. Click on the 3D structure to view it rotate.

MC4R belongs to the family of melanocortin receptors, which are seven transmembrane (TM) spanning G-protein coupled receptors (GPCRs) (Figure 3 & 4). MC4R activates the heterotrimeric G-protein Gs, which stimulates adenylyl cyclase production of cAMP from ATP (2). Based on a pure modeling approach modeled upon the crystal structure of bovine rhodopsin, another GPCR, residues in transmembrane domain (TM)3, TM4, TM5 and TM6 were predicted to flank the ligand binding site. Extracellular loops 2 and 3 also participate in docking of ligand (3). Interestingly, TM1 and TM7 were not predicted to contribute to ligand binding, although F284 was found at the edge of the ligand-binding pocket (3). The third intracellular loop of MC4R is predicted to form an α-helical segment, and play an important role in coupling the receptor to Gs. The chubby mutation causes a valine to glutamic acid substitution at amino acid 65 within TM1.

Please see the record for Southbeach for more information about Mc4r.

Putative Mechanism

A main mechanism of energy balance regulation involves the control of signaling by the central melanocortin receptors (MCRs) MC3R and MC4R within a defined hypothalamic neural network. Two sets of neurons in the arcuate nucleus (a region surrounding the third ventricle in the most ventral portion of the hypothalamus) act as sensors of whole-body energy status and initiate signals to maintain energy stores at a constant level. The Agrp/Npy neurons (producing Agrp and neuropeptide Y) are inhibited by the leptin peptide (see the record for Potbelly) by signaling through the leptin receptor (see the record for Business_class), while Pomc/Cart neurons (producing Pomc; its proteolytic products and cocaine- and amphetamine-regulated transcript) are stimulated by leptin (4-6). Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons (4;7). Thus, when leptin levels are low, Agrp/Npy neurons are activated and Pomc/Cart neurons are inhibited, producing Agrp but not Pomc, and resulting in inhibition of MC4R and increased food intake. In humans, mutations in MC4R are associated with obesity (OMIM #601665). Human patients with MC4R mutations exhibit increased body mass index, increased appetite, increased height, increased lean mass, increased bone mineral density and hyperinsulinemia (8). With the exception of increased bone mineral density, these phenotypes are recapitulated in Mc4r null mice (9). The localization, expression, and function of the MC4Rchubby protein have not been determined; however, the obesity phenotype of the chubby mice indicates that the mutation results in loss of MC4R function.

Primers PCR Primer
chubby_pcr_F: TGCGAGCAAGGAGCTACAGATCAC
chubby_pcr_R: ACCCAGGAGGTTGGATCAGTTCAAG

Sequencing Primer
chubby_seq_F: AGCTACAGATCACAGAGTCAATG
chubby_seq_R: TCAGTTCAAGGAGGACTCAAATC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 459 nucleotides is amplified (chromosome 18, - strand):


1   acccaggagg ttggatcagt tcaaggagga ctcaaatcca gctgctgcag gaagatgaac
61  tccacccacc accatggcat gtatacttcc ctccacctct ggaaccgcag cagctacggg
121 ctgcacggca atgccagcga gtcgctgggg aagggccacc cggacggagg atgctatgag
181 caactttttg tttcccccga ggtgtttgtg actctgggtg tcataagcct gttggagaac
241 attctagtga tcgtggcgat agccaagaac aagaacctgc actcacccat gtactttttc
301 atctgtagcc tggctgtggc agatatgctg gtgagcgttt cgaatgggtc ggaaaccatc
361 gtcattaccc tgttaaacag tacggatacg gatgcccaga gcttcaccgt gaacattgat
421 aatgtcattg actctgtgat ctgtagctcc ttgctcgca


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Jianhui Wang