Phenotypic Mutation 'Lostnf2'

• Allele: Lostnf2
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 116,491,017 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Rhbdf2
• Gene Name: rhomboid 5 homolog 2
• Synonym(s): cub, iRhom2, 4732465I17Rik, Rhbdl6, Uncv
• Chromosomal Location: 116,488,991-116,517,786 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for a null mutation display impaired TNF secretion and increased sensitivity to bacterial infection induced mortality. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Glutamic Acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000099317] [ENSMUSP00000099318]
• AlphaFold: Q80WQ6
• SMART Domains: Protein: ENSMUSP00000099317; Gene: ENSMUSG00000020806; AA Change: V645E

Domain	Start	End	E-Value	Type
Pfam:Rhomboid_SP	98	306	1.8e-98	PFAM
transmembrane domain	376	398	N/A	INTRINSIC
Pfam:Rhomboid	619	763	4.6e-31	PFAM
transmembrane domain	775	797	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000103028)
• SMART Domains: Protein: ENSMUSP00000099318; Gene: ENSMUSG00000020806; AA Change: V645E

Domain	Start	End	E-Value	Type
Pfam:Rhomboid_SP	98	304	4.7e-97	PFAM
transmembrane domain	376	398	N/A	INTRINSIC
Pfam:Rhomboid	619	763	8.1e-31	PFAM
transmembrane domain	775	797	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000103029)
• Meta Mutation Damage Score: 0.9297
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• MMRRC Submission: 038177-MU
• Last Updated: 2019-09-04 9:46 PM by Katherine Timer
• Record Created: 2015-03-15 11:48 PM by Zhao Zhang
• Record Posted: 2015-03-25
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Zhao Zhang, Ying Wang, Hexin Shi, Doan Dao, Lei Sun, Bruce Beutler

Accession Number

NCBI RefSeq: NM_172572, NM_001167680; MGI:2442473

Alleles Listed at MGI

All mutations/alleles(39) : Chemically induced (ENU)(2) Gene trapped(32) Targeted(5)

Phenotypic Description

Figure 1. Lostnf2 mice exhibited decreased TNFα secretion in response to the TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lostnf2 mice exhibited decreased TNFα secretion in response to the TLR1/2 ligand, Pam3CSK4. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Lostnf2 mice exhibited decreased TNFα secretion in response to the TLR7/8 ligand, R848. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lostnf2 phenotype was identified among ENU-mutagenized G3 mice of the pedigree R1839, some of which exhibited decreased TNFα (see the record for PanR1) secretion in response to the Toll-like receptor (TLR) ligands LPS (TLR4; Figure 1), Pam3CSK4 (TLR1/2; Figure 2) and R848 (TLR7/8; Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced TNFα secretion after LPS stimulation using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R0304. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Rhbdf2: a T to A transversion at base pair 116,600,191 (v38) on chromosome 11, or base pair 26,829 in the GenBank genomic region NC_000077. The strongest association was found with an additive model of linkage to the normalized TLR4 response, wherein 29 variant heterozygotes and 2 variant homozygotes departed phenotypically from 18 homozygous reference mice with a P value of 1.038 x 10^-11 (Figure 4). The mutation corresponds to residue 2,455 in the mRNA sequence NM_172572 within exon 18 of 19 total exons.

2439 CACTGCCTTGTGTCTGTGGTCTTCCAAATGACC 639 -H--C--L--V--S--V--V--F--Q--M--T-

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to glutamic acid (E) substitution at position 645 (V645E) in the RHBDF2 protein.

Protein Prediction

Figure 5. Domains of RHBDF2. (A) RHBDF2 has predicted TMDs occurring at amino acids 382-402, 628-648, 664-684, 687-707, 719-739, 745-765, and 774-794; the 381 N-terminal amino acids are predicted to be cytoplasmic. RHBDF2 has predicted phosphorylation sites at serines 60, 83, 87, 293, 295, and 298 as well as an N-glycosylation site at amino acid 555. The Lostnf2 mutation causes a valine to glutamic acid substitution at amino acid 645. Image is interactive; click to view other Rhbdf2 mutations. (B) The iRhoms have a 6 + 1 TMD membrane topology. The N-terminus is cytoplasmic; the C-terminus is intracellular. The Lostnf2  mutation (V645E) is indicated by a red asterisk. Image is interactive; click to view other Rhbdf2 mutations.

Rhbdf2 or iRhom2 encodes an 827 amino acid rhomboid-like protein (Figure 5A). RHBDF2 is considered to be an iRhom, a conserved group of proteolytically inactive rhomboid-like proteins with proline residues in their active site and characteristic luminal loop domains (1). The iRhoms have a 6 + 1 transmembrane domain (TMD) membrane topology (1); the Lostnf2 mutation (V645E) occurs within TMD 2 (alternatively, TMD 1 within the 6 TMD cluster) (Figure 5B).

For more information on RHBDF2, see the record for sinecure.

Putative Mechanism

Rhomboid proteases are involved in many different biological processes in diverse organisms [reviewed in (2)]. The role of RHBDF2 in innate immunity has been studied using Rhbdf2 knockout (Rhbdf2^-/-) mouse models (3;4). Ablation of Rhbdf2 had no effect on the induction of IL-1β, IL-6, and IL-12 by peritoneal macrophages upon LPS stimulation (3). However, TNF-α secretion by LPS-stimulated macrophages was reduced; TNF-α mRNA and protein levels were upregulated normally and TNF-α was expressed appropriately at the plasma membrane of Rhbdf2^-/- macrophages. Adrain et al. proposed there was a defect in the shedding of the ectodomain of TNF-α, a process necessary for TNF-α activation (3). Further examination of the Rhbdf2^-/-macrophages found that TNF-α converting enzyme (TACE; see the record for wavedX) was absent from the cell surface due to an inability of the protein to traffic from the ER to the trans-Golgi network. TACE activity is essential for the cleavage of TNF-α to yield the bioactive form in response to numerous stimuli including PMA and LPS (5-7). Taken together, RHBDF2 is either involved in the folding and/or maturation of TACE in the ER, or it is a cargo receptor that assists in the trafficking of TACE (3;4). Loss of RHBDF2 function, as in the Lostnf2 and sinecure mice (8), would lead to an inability of TACE to exit the secretory pathway and a subsequent failure in cleavage and release of TNF from the cell surface. 

Primers

PCR Primer
Lostnf2_pcr_F: CCAAAAGGAAGGGCTCATCC
Lostnf2_pcr_R: TTCCTGCATGCTGGGTAAG

Sequencing Primer
Lostnf2_seq_F: GGCTCATCCCACCCTCTCTG
Lostnf2_seq_R: TAAGAGGCACCCTGTTGCC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 404 nucleotides is amplified (chromosome 11, - strand):

1   ttcctgcatg ctgggtaaga ggcaccctgt tgccccatgc tcagactccc atgtctcccc
61  tcttgggtgc cggagaaaag ggcttccaga ccgagcacac tggctcaacc tgctagtgct
121 agactgcgct gtggtgtgct ctgcgggtga ccatgggcac acaggaaagg ctgatggtgc
181 tcatgtgcct accccagcat agtgcactgc cttgtgtctg tggtcttcca aatgaccatc
241 ctgagggacc tagagaagct ggccggctgg caccgcatct ccatcatctt catccttagt
301 ggcattacag gcaacctggc cagcgccatc ttcctcccct accgggcaga ggtacaaact
361 tgggagacaa gggcagagag ggtgggatga gcccttcctt ttgg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Lemberg, M. K., and Freeman, M. (2007) Cutting Proteins within Lipid Bilayers: Rhomboid Structure and Mechanism. Mol Cell. 28, 930-940.

  2. Freeman, M. (2008) Rhomboid Proteases and their Biological Functions. Annu Rev Genet. 42, 191-210.

  3. Adrain, C., Zettl, M., Christova, Y., Taylor, N., and Freeman, M. (2012) Tumor Necrosis Factor Signaling Requires iRhom2 to Promote Trafficking and Activation of TACE. Science. 335, 225-228.

  4. McIlwain, D. R., Lang, P. A., Maretzky, T., Hamada, K., Ohishi, K., Maney, S. K., Berger, T., Murthy, A., Duncan, G., Xu, H. C., Lang, K. S., Haussinger, D., Wakeham, A., Itie-Youten, A., Khokha, R., Ohashi, P. S., Blobel, C. P., and Mak, T. W. (2012) IRhom2 Regulation of TACE Controls TNF-Mediated Protection Against Listeria and Responses to LPS. Science. 335, 229-232.

  5. Hikita, A., Tanaka, N., Yamane, S., Ikeda, Y., Furukawa, H., Tohma, S., Suzuki, R., Tanaka, S., Mitomi, H., and Fukui, N. (2009) Involvement of a Disintegrin and Metalloproteinase 10 and 17 in Shedding of Tumor Necrosis Factor-Alpha. Biochem Cell Biol. 87, 581-593.

  6. Huovila, A. P., Turner, A. J., Pelto-Huikko, M., Karkkainen, I., and Ortiz, R. M. (2005) Shedding Light on ADAM Metalloproteinases. Trends Biochem Sci. 30, 413-422.

  7. Zheng, Y., Saftig, P., Hartmann, D., and Blobel, C. (2004) Evaluation of the Contribution of Different ADAMs to Tumor Necrosis Factor Alpha (TNFalpha) Shedding and of the Function of the TNFalpha Ectodomain in Ensuring Selective Stimulated Shedding by the TNFalpha Convertase (TACE/ADAM17). J Biol Chem. 279, 42898-42906.

  8. Siggs, O. M., Xiao, N., Wang, Y., Shi, H., Tomisato, W., Li, X., Xia, Y., and Beutler, B. (2012) IRhom2 is Required for the Secretion of Mouse TNF Alpha. Blood. 119, 5769-71.