Phenotypic Mutation 'Asura' (pdf version)
List |< first << previous [record 25 of 511] next >> last >|
AlleleAsura
Mutation Type missense
Chromosome9
Coordinate106,224,647 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Tlr9
Gene Name toll-like receptor 9
Chromosomal Location 106,222,598-106,226,883 bp (+)
MGI Phenotype Mice homozygous for a knock-out allele exhibit impaired immune system response to LPS, CpG, and Leishmania bazillensis infection.
Accession Number

NCBI RefSeq: NM_031178; MGI:1932389

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Gene Model not available
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: L379P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000062241)
Phenotypic Category TLR signaling defect: hyposensitivity to CpG
Penetrance  
Alleles Listed at MGI

All mutations/alleles(10) : Chemically induced (ENU)(8) Gene trapped(1) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 0.99
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.86
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 0.99
IGL02851:Tlr9 APN 9 106224730 nonsense probably null 0.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 0.99
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
Cpg7 UTSW 9 106225349 missense probably benign 0.01
Meager UTSW 9 106224139 missense probably damaging 1.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.02
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign 0.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.11
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.65
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 unclassified probably null
Mode of Inheritance Autosomal Semidominant
Local Stock
MMRRC Submission
Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 03/16/2015 4:24 PM by Lei Sun
Record Posted 03/23/2015
Phenotypic Description

Figure 1. Asura mice exhibited decreased TNFα secretion in response to the TLR9 ligand, CpG ODN. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Asura phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1940, some of which showed decreased TNFα (see the record for PanR1) secretion in response to the Toll-like receptor 9 (TLR9) ligand CpG oligodeoxynucleotide (CpG ODN; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of reduced TNFα secretion after CpG ODN stimulation using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 117 mutations (X-axis) identified in the G1 male of pedigree R1940. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 117 mutations. The reduced TLR9 response was linked by continuous variable mapping to a mutation in Tlr9:  a T to C transition at base pair 106,224,647 (v38) on chromosome 9, or base pair 2,050 in the GenBank genomic region NC_000075 encoding Tlr9.  Linkage was found with an additive model of inheritance, wherein 6 variant homozygotes and 8 heterozygotes departed phenotypically from 3 homozygous reference mice with a P value of 6.319 x 10-9 (Figure 2).  The mutation corresponds to residue 1,242 in the mRNA sequence NM_031178 within exon 2 of 2 total exons.

 

1226 ATCTTCTTCCGCTTGCTCAACAAGTACACGCTC

375  -I--F--F--R--L--L--N--K--Y--T--L-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at position 379 (L379P) in the TLR9 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 3. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The amino acid affected by the Asura mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The Asura mutation (red asterisk) results in a leucine to proline change at position 379 in the TLR9 protein in the predicted twelfth LRR. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.

TLR9 is a type I integral membrane glycoprotein. The cytoplasmic domain of TLR9 shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (1-3), which mediates homo- and heterotypic protein interactions during signal transduction. The extracellular domains of TLRs contain multiple leucine rich repeats (LRRs) that mediate ligand recognition by TLRs. TLR9 has 25 LRRs in its ectodomain. The Asura mutation causes a leucine to proline substitution at amino acid 379 within the predicted twelfth LRR of the TLR9 ectodomain (Figure 3).

 

Please see the record for CpG1 for more information about Tlr9.

Putative Mechanism

Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms by recognizing conserved molecular motifs found in many different pathogens, including bacteria, fungi, protozoa and viruses. TLR9 is specific for double-stranded DNA unmethylated at CpG motifs (1). Together with TLRs 3, 7, and 8, TLR9 detects bacterial and viral nucleic acids. The Asura phenotype indicates that a proline at amino acid 379 position fails to support normal function of TLR9. The mutation may disrupt ligand binding, receptor dimerization, or destroy proper folding or localization of the receptor.

Primers PCR Primer
Asura(F):5'- CTTCCTGGTTCCAAGGTCTG -3'
Asura(R):5'- TTCTGACAGCGTTGAAGGCC -3'

Sequencing Primer
Asura_seq(F):5'- TGCTGGACCTAAGCGAGAACTTTC -3'
Asura_seq(R):5'- CCACTGATGCGATTGTCTGACAAG -3'
Genotyping

NOTE: These primers have not been validated; Primer ID: R19400068

 

Asura genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Asura (F): 5’- CTTCCTGGTTCCAAGGTCTG-3’

Asura (R): 5’- TTCTGACAGCGTTGAAGGCC-3’

 

Sequencing Primers

Asura_seq(F): 5’- TGCTGGACCTAAGCGAGAACTTTC-3’
 

Asura_seq(R): 5’- CCACTGATGCGATTGTCTGACAAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 404 nucleotides is amplified (Chr.11: 106224413-106224816, GRCm38; NCBI RefSeq:NC_000075):

 

cttcctggtt ccaaggtctg gtcaacctct cggtgctgga cctaagcgag aactttctct

atgaaagcat cacccacacc aatgcctttc agaacctaac ccgcctgcgc aagctcaacc

tgtccttcaa ttaccgcaag aaggtatcct ttgcccgcct ccacctggca agttccttta

agaacctggt gtcactgcag gagctgaaca tgaacggcat cttcttccgc ttgctcaaca

agtacacgct cagatggctg gccgatctgc ccaaactcca cactctgcat cttcaaatga

acttcatcaa ccaggcacag ctcagcatct ttggtacctt ccgagccctt cgctttgtgg

acttgtcaga caatcgcatc agtgggcctt caacgctgtc agaa

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated T (T>C) is shown in red text.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsLei Sun, Bruce Beutler
List |< first << previous [record 25 of 511] next >> last >|