Phenotypic Mutation 'lohan'

• Allele: lohan
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 113,737,611 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Atp2b2
• Gene Name: ATPase, Ca++ transporting, plasma membrane 2
• Synonym(s): PMCA2, Gena300, wms, D6Abb2e, jog, Tmy
• Chromosomal Location: 113,720,803-114,019,574 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000086398] [ENSMUSP00000098605] [ENSMUSP00000098606] [ENSMUSP00000138165] [ENSMUSP00000145174]
• AlphaFold: Q9R0K7
• SMART Domains: Protein: ENSMUSP00000086398; Gene: ENSMUSG00000030302; AA Change: L925P

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	156	444	1.7e-56	PFAM
Pfam:Hydrolase	448	787	3.9e-25	PFAM
Pfam:HAD	451	784	2.4e-16	PFAM
Pfam:Hydrolase_like2	497	593	9.4e-17	PFAM
Pfam:Hydrolase_3	745	820	1.7e-6	PFAM
transmembrane domain	833	855	N/A	INTRINSIC
Pfam:Cation_ATPase_C	857	1039	7.3e-46	PFAM
low complexity region	1057	1070	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1081	1144	1.4e-31	PFAM
low complexity region	1151	1166	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000089003)
• SMART Domains: Protein: ENSMUSP00000098605; Gene: ENSMUSG00000030302; AA Change: L970P

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	155	307	4.2e-28	PFAM
low complexity region	313	330	N/A	INTRINSIC
low complexity region	337	356	N/A	INTRINSIC
Pfam:E1-E2_ATPase	373	488	1.4e-13	PFAM
Pfam:Hydrolase	493	832	8.1e-16	PFAM
Pfam:HAD	496	829	6.3e-21	PFAM
Pfam:Cation_ATPase	542	638	4.4e-17	PFAM
Pfam:Hydrolase_3	791	865	8.3e-7	PFAM
transmembrane domain	878	900	N/A	INTRINSIC
Pfam:Cation_ATPase_C	902	1084	2.5e-47	PFAM
low complexity region	1102	1115	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1126	1178	2.4e-30	PFAM
low complexity region	1196	1211	N/A	INTRINSIC
low complexity region	1220	1234	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000101044)
• SMART Domains: Protein: ENSMUSP00000098606; Gene: ENSMUSG00000030302; AA Change: L925P

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	156	444	1.7e-56	PFAM
Pfam:Hydrolase	448	787	3.9e-25	PFAM
Pfam:HAD	451	784	2.4e-16	PFAM
Pfam:Hydrolase_like2	497	593	9.4e-17	PFAM
Pfam:Hydrolase_3	745	820	1.7e-6	PFAM
transmembrane domain	833	855	N/A	INTRINSIC
Pfam:Cation_ATPase_C	857	1039	7.3e-46	PFAM
low complexity region	1057	1070	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1081	1144	1.4e-31	PFAM
low complexity region	1151	1166	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000101045)
• SMART Domains: Protein: ENSMUSP00000138165; Gene: ENSMUSG00000030302; AA Change: L925P

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	156	444	6.1e-57	PFAM
Pfam:Hydrolase	448	787	1.4e-25	PFAM
Pfam:HAD	451	784	7.7e-17	PFAM
Pfam:Hydrolase_like2	497	593	4.4e-17	PFAM
Pfam:Hydrolase_3	745	820	4.2e-7	PFAM
transmembrane domain	833	855	N/A	INTRINSIC
Pfam:Cation_ATPase_C	857	1039	2.7e-46	PFAM
low complexity region	1057	1070	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1081	1149	1.3e-19	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000152831)
• SMART Domains: Protein: ENSMUSP00000145174; Gene: ENSMUSG00000030302; AA Change: L921P

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	155	310	1.9e-28	PFAM
Pfam:E1-E2_ATPase	328	443	1.1e-13	PFAM
Pfam:HAD	451	780	2.7e-19	PFAM
Pfam:Cation_ATPase	497	593	5.8e-17	PFAM
Pfam:Hydrolase	576	783	2e-8	PFAM
Pfam:Hydrolase_3	711	816	2.3e-7	PFAM
transmembrane domain	829	851	N/A	INTRINSIC
Pfam:Cation_ATPase_C	853	1035	2.5e-47	PFAM
low complexity region	1053	1066	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1077	1129	2.6e-30	PFAM
low complexity region	1147	1162	N/A	INTRINSIC
low complexity region	1171	1185	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000205052)
• Meta Mutation Damage Score: 0.9745
• Is this an essential gene?: Probably essential (E-score: 0.889)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 038187-MU
• Last Updated: 2019-09-04 9:45 PM by Diantha La Vine
• Record Created: 2015-04-01 3:37 PM by Jeff SoRelle
• Record Posted: 2015-04-30
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle, Zhe Chen

Accession Number

NCBI RefSeq: NM_009723, NM_001036684; MGI:105368

Alleles Listed at MGI

All mutations/alleles(18) : Chemically induced (ENU)(5) Gene trapped(2) Spontaneous(8) Targeted(3)

Phenotypic Description

Figure 1. The lohan phenotype.

The lohan phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2127, some of which exhibited ataxia, head bobbing, limb clasping, abnormal movements when held, and mild tremor (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 100 mutations. Among these, only one affected a gene with known neurological functions, Atp2b2. The mutation in Atp2b2 was presumed to be causative because the lohan ataxia phenotype mimics other known alleles of Atp2b2 (see MGI for a list of Atp2b2 alleles). The Atp2b2 mutation is a T to C transition at base pair 113,760,650 (v38) on chromosome 6, or base pair 281,964 in the GenBank genomic region NC_000072. The mutation corresponds to residue 3,402 in the mRNA sequence NM_009723 (variant 1) within exon 18 of 22 total exons and residue 3,213 in the mRNA sequence NM_001036684 (variant 2) within exon 16 of 20 total exons, and residue 3,520 in the cDNA transcript ENSMUST00000101044 (variant 3) within exon 20 of 24 total exons.

281948 CTCATCTTCACCCTGCTCTTCGTGGGTGAGAAG 920    -L--I--F--T--L--L--F--V--G--E--K- (isoform 1; NP_033853 ) 920    -L--I--F--T--L--L--F--V--G--E--K- (isoform 2; NP_001031761 ) 965    -L--I--F--T--L--L--F--V--G--E--K- (isoform 3; ENSMUSP00000098605)

Genomic numbering corresponds to NC_000072. The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at position 925 (L925P) in isoform 1 and 2 and L970P in isoform 3 of the encoded proteins, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1).

Protein Prediction

Figure 2. Topology and domain structure of PMCA2. The protein product of the w/a Atp2b2 transcript is shown. The transmembrane domains are indicated as well as the calmodulin (CaM)-binding site. The A, P, N, and M regions are indicated (see Figure 3 and 5 for more details on these regions). PMCA2 undergoes alternative splicing at two sites (within cytoplasmic loops between transmembrane domains 2 and 3 (A site) and within the CaM-binding domain (site C) potentially altering two regions of the protein. The mutation in lohan results in a leucine (L) to proline (P) substitution at position 925 (L925P). For more details about the transcripts generated by Atp2b2 alternative splicing, see the text and Table 1.

Figure 3. Crystal structure of rabbit (Oryctolagus cuniculus) Sarcoplasmic/Endoplasmic Reticular Ca²⁺-ATPases (SERCA). The SERCA protein is shown in both a closed (left) and open (right) conformation. The A, P, N, and M regions are indicated (see Figure 1 and 4 as well as the text for more details). Both figures were generated by UCSF Chimera. The closed conformation SERCA is based on PDB:1IWO and the open conformation SERCA is based on PDB:1SU4.

PMCA2 is a member of the P-type superfamily of ATPases, a large group of evolutionarily related ion pumps that use the free energy of ATP hydrolysis to drive transport and establish ion gradients across membranes (2). PMCA2 is closely related to other cation transport ATPases including the H,K-ATPase (e.g., ATP4A; see the record for sublytic) and the Na,K-ATPase. The P-type ATPases can be divided into five subfamilies based on sequence conservation and the nature of the substrate transported; the ATPase-encoding genes are typically designated by an additional number and letter to indicate the subgroup in which it belongs (i.e., Atp2b2 indicates gene 2 in subgroup 2B) (3;4). In all P-type ATPases both the N- and C-termini are located on the cytoplasmic side of the membrane such that these proteins contain an even number of transmembrane segments [Figure 2; (5;6); PDB: 1IWO and PDB:1SU4]. Four well-defined, conserved protein domains exist in P-type ATPases: the phosphorylation (P) domain, nucleotide-binding (N) domain, actuator (A) domain, and membrane (M) domain [Figure 3; (6).  The P, N, and A domains are positioned cytoplasmically, whereas the M domain spans the plasma membrane. 

Atp2b2 undergoes alternative splicing to generate several variants (Table 1 and Figure 2). Splicing affects site A within the first cytosolic loop between TM2 and TM3 as well as site C in the CaM-binding domain. The site A insertion comprises up to 3 exons. Variants with 1, 2, or 3 inserted exons are referred to as x, y, and w, respectively; variants without a site A insert are referred to as z (7-9). Site A splicing is in-frame and does not significantly alter the structure of PMCA2. A variable number of amino acids (14-45 in human PMCA2) are inserted into the loop as a result of splicing at site A (9;10). Differential splicing at site A regulates the membrane targeting of PMCA2 (10). The w, but not x or z, variants, target to the apical membrane (10). Insertion at site C involves either no insertion of additional exons (variant b), or the insertion of one exon (variant a). Splicing at site C results in coding of a premature stop codon that truncates the protein approximately 50 amino acids upstream of the canonical C-terminus, within the CaM-binding domain. The a variants are more rapidly activated by Ca²⁺, and extrude intracellular Ca²⁺ at a higher rate than the b variants (11). The b variants exhibit reduced CaM dependence (12) with a concomitant increase in PKC phosphorylation sites (13). The b variants display delayed activation compared with the a variants, but upon activation the b variants maintain a high rate of Ca²⁺ extrusion even after intracellular calcium returns to basal levels (14;15). The b variants interact with several PDZ (PSD95/Dlg/ZO-1) proteins including Na⁺/H⁺ exchanger regulatory factor-2 (NHERF2) in apical plasma membranes (16;17). The interaction between NHERF2 and PMCA2b is proposed to facilitate the assembly of PMCA2 into a multiprotein Ca²⁺ signaling complex (16). Silverstein et al. identified four different first exons within mouse Atp2b2 that are each associated with a unique promoter and enhancer region, termed type α, β, μ and δ [Table 1; (18)]. The type α and β transcripts were previously published cDNA sequences. The use of the different first exons results in tissue-specific expression of the transcripts.

Table 1. Atp2b2 isoforms

Designation (A site/C site)	Molecular description	Localization	References
w/a	3 exons at site A; 1 exon at site C	Cochlear outer hair cells and Purkinje neurons	(7-10;19-22)
w/b	3 exons at site A; no extra exons at site C	Lactating mammary gland
x/a	1 exon at site A; 1 exon at site C	Purkinje neurons
x/b	1 exons at site A; no extra exons at site C
y/a	2 exons at site A; 1 exon at site C	Purkinje neurons
y/b	2 exons at site A; no extra exons at site C
z/a	No extra exons at site A; 1 exon at site C	Purkinje neurons
z/b	No extra exons at site A; no extra exons at site C (i.e., full-length PMCA2)
Type α	Exons utilized: IIα and IIIα (within the 5’ UTR) as well as exon 1 (contains ATG)	Purkinje neurons and cochlear hair cells	(18;23)
Type β	Exons utilized: Iβ (within the 5’ UTR) as well as exon 1 (contains ATG)	Neurons
Type μ	Exons utilized: Iμ (within the 5’ UTR) as well as exon 1 (contains ATG)	Lactating mammary gland
Type δ	Exons utilized: IIIα and Iδ (within the 5’ UTR) as well as exon 1 (contains ATG)	Lactating mammary gland

Figure 4. The E1/E2 model of the P-type ATPase ion translocation cycle. See text for details.

P-type ATPases cycle through a series of conformational changes to translocate ions.  The Post-Albers or E1/E2 model of the reaction cycle (24;25) has been widely used to explain the functional transitions of P-type ATPases that facilitate ion transport.  The model proposed two conformational states, E1 and E2, where the E1 state has high-affinity binding sites for the ion to be transported from the cytoplasmic side of the membrane, and the E2 state has high-affinity binding sites for the ion to be transported from the extracellular side of the membrane (Figure 4).  In the first step, ion1 binds to E1 from inside the cell, triggering autophosphorylation of the enzyme by Mg²⁺-ATP on a conserved aspartate residue (see below), which leads to the phosphorylated E1-P state.  E2-P is formed by rate-limiting conformational changes to E1-P.  E2-P has reduced affinity for ion1, which is thus released outside the cell. E2-P is unable to phosphorylate ADP, meaning that the reaction cannot proceed in the reverse direction from E2-P.  Ion2 binds to E2-P from the outside of the cell, leading to hydrolysis of the phosphorylated aspartate, which triggers release of ion2 inside the cell and a return to the E1 state.  The utility of the E1/E2 model has recently been questioned because of some inaccuracies identified experimentally (26), but it still seems to be generally accepted and appears in many current publications.

Figure 5. In the E1 state, interactions with residues in the M domain promote the binding of Ion1 from the cytoplasmic side of the membrane. This promotes a conformational change in the P domain that results in the autophosphorylation of the critical aspartate residue by Mg-ATP, which is brought to the phosphorylation site by the N domain. A conformational change involving the P domain and a rotation of the A domain converts the autophosphorylated E1-P state to the E2-P state. From the E2-P state the reverse reaction, i.e. , hydrolysis of the phosphoryl group and phosphorylation of ADP, cannot occur. In E2-P, access to the ion binding site from the cytoplasm is close and the high affinity Ion1-binding site is disrupted, causing Ion1 to be released to the outside of the cell through an exit channel. The ion binding site now has high affinity for Ion2, which enters from the outside of the cell. Hydrolysis of the phosphorylated aspartate brings the enzyme to the E2 state, in which the ion binding site opens to the inside of the cell and Ion2 is released, resulting in the E1 state and the beginning of another cycle.

The P domain is the catalytic core of P-type ATPases, containing a conserved sequence (DKTGTLT) in which the aspartate residue is reversibly autophosphorylated to form the high energy E1-P intermediate of the reaction cycle (27).  The P domain is flanked by TM4 and TM5 and assembles into a seven-stranded parallel β-strand and eight short α-helices, forming a Rossmann fold (6). Surrounding the β-strand are the residues that are essential for ATP hydrolysis (6). The P domain in PMCA2 comprises the catalytic region and includes the ATP binding site and the aspartate residue that forms the acyl phosphate during ATP hydrolysis. The N domain is linked to the P domain by a conserved hinge of two antiparallel strands, and serves to bind Mg²⁺-ATP and deliver it to the phosphorylation site in the P domain. The N domain contains the ATP-binding pocket and is inserted in the P domain (6). The N domain is comprised of a seven-stranded antiparallel β-strand surrounded by two helix bundles (6). The A domain comprises the domain between TM2 and TM3 and is comprised of two short helices (6). The A domain does not interact with ions or nucleotides, but undergoes a rotation during the E1-P to E2-P transition that places it in contact with the phosphorylation site, inducing conformational changes of the P and M domains that may serve to cause release of ion1 and binding of ion2. The A domain in PMCA2 comprises the transduction domain, which is proposed to mediate long-range transmissions of conformational changes that occur during the transport cycle. The M domain consists of ten membrane-spanning helices that surround the ion-binding sites, and is directly linked to the P domain through helices M4 and M5.  Reciprocal movements of M domain helices have been proposed to open, in turn, the ion binding cavities facing the cytoplasm and extracellular space, and create high affinity binding sites for different ions through the reorientation of coordinating side chains.  Amino acid sequences of M domains are the least conserved of all P-type ATPase domains, reflecting the distinct ionic specificities of each transporter.  A schematic depiction of the catalytic cycle of P-type ATPases conforming to the E1/E2 model is shown in Figure 5.

The C-terminal tail of PMCA2 interacts with two sites within the first and second cytosolic loops to prevent high-affinity Ca²⁺ binding and transport while the levels of intracellular are Ca²⁺ low (28). The C-terminal tail also contains a calmodulin (CaM)-binding domain, protein kinase A (PKA) and PKC phosphorylation sites, and sites for protein-protein interactions that mediate PMCA2 membrane localization, targeting, and signaling cross-talk (28). Binding of CaM to PMCA2 is inhibitory, maintaining PMCA2 in an inactive state in the presence of low intracellular free Ca²⁺ (28).

The lohan mutation results in a leucine (L) to proline (P) substitution at position 925 (L925P). L925 is within the extracellular loop between TM7 and TM8.

Expression/Localization

PMCA2 is highly expressed in the nervous system and the mammary gland; lower levels are expressed in the liver, kidney, uterus, and retina (18;29). Within the brain, PMCA2 is expressed at high levels in the cerebellum, especially in Purkinje neurons. In the inner ear, PMCA2 is highly expressed in the stereocilia of the outer hair cells of the organ of Corti and the spiral ganglion neurons (30;31). Within the outer hair cells, PMCA2 is localized in the sterocilia. See Table 1 for a description of the tissue-specific localization of the PMCA2 isoforms.

Background

Calcium  is a second messenger signal that regulates cellular function. Maintenance of Ca²⁺ levels in the cell requires methods of Ca²⁺ extrusion systems at the plasma membrane that compensate for the influx of Ca²⁺ from the extracellular space. Malfunction of Ca²⁺ transport across membranes can often result in Ca²⁺ overload and cell death. The Na⁺/Ca²⁺ exchanger, ATP-dependent transporters (i.e., Sarcoplasmic/Endoplasmic Reticular Ca²⁺-ATPases (SERCA) in the in the endo(sarco)plasmic reticulum, Secretory Pathway Ca²⁺-ATPases (SPCA) at the Golgi apparatus, PCMAs at the plasma membrane), the mitochondrial Ca²⁺ uniporter, and a variety of Ca²⁺ binding and buffering proteins function in the regulation of Ca²⁺ homeostasis in the cell by mediating Ca²⁺ influx in the cytosol or to the lumen of organelles. PMCA2 has several known functions that are described in detail, below.

Figure 6. PMCA2 is essential to maintain calcium levels in the inner ear. (A) Inner hair cells are located within the organ of Corti. The hair bundle is composed of numerous stereocilia that develop from microvilli and have a stiff core of parallel actin filaments anchored in the cuticular plate, a meshwork of horizontal actin filaments beneath the apical cell membrane. Lateral to the tallest stereocilium is the kinocilium, which is formed from the basal body. The stereocilia are connected to each other by numerous filaments, including tip links, horizontal top connectors, transient lateral links and ankle links. The synaptic junction between the hair cell and afferent and efferent neurons is located at the base of the cell and contains ribbons. (B) The molecular components of the cross link complexes of the inner ear hair cell. In the tip link, cadherin23 interacts with protocadherin15, harmonin, Myo7a, Myo1c, calmodulin, and Sans to help maintain the structure and function of the inner ear hair cell.

PMCA2 in the inner ear

Hearing and balance both depend on the function of hair cells of the inner ear.  The hair cells of the inner ear are mechanosensors that perceive sound, head movement, and gravity (32).  These are polarized epithelial cells that have a hair bundle located at their apical poles that detects sound-induced movements of the cochlear fluids and subsequently transduces those stimuli into electrical signals (33). Each hair cell in the inner ear is comprised of a bundle of up to 300 stereocilia that project from the apical cell surface (34); each stereocilium is filled with up to 1000 polarized and cross-linked actin filaments (Figure 6). The stereocilia are organized in a staircase pattern and held together by extracellular lateral projections (tip links, horizontal top connectors, shaft connectors, transient lateral links and ankle links). The stereocilia and apical surfaces of hair cells are surrounded by endolymphatic fluid that contains Ca²⁺. Cadherin 23 (Cdh23; see the record for dee_dee) and protocadherin 15 (Pcdh15; see the record for squirm) are Ca²⁺-binding proteins that form the tip links; binding of Ca²⁺ maintains the structural integrity of the tip links and removal of Ca²⁺ leads to degeneration (35;36). Deflection of the hair bundle results in gating of cation-selective transducer channels at the tips of the stereocilia, which facilitates endolymph potassium and Ca²⁺ to flow in and depolarize the hair cells. The modulation of the cell membrane potential converts the sound-evoked mechanical stimulus into an electrical signal (i.e., mechano-electrical transduction) (34;37;38). Prolonged hair bundle deflection, termed adaptation, is mediated by Ca²⁺ binding to CaM, which regulates the function of myosin 1-beta, a molecular motor of adaptation (39). PMCA pumps transport Ca²⁺ back to the endolymph, which increases the rate and extent of adaptation (40). Loss of PMCA2 function results in deafness and equilibrium defects in both mice (41-46) and humans (21;47). For more information about proteins involved in the maintenance and function of the hair cells of the inner ear please see the records for dee dee, squirm, and parker.  

PMCA2 in Purkinje cells

Purkinje cells are the principal neurons within the cerebellar cortex. Calcium influx through P/Q- and T-type Ca²⁺ channels mediates chronic activation of type I metabotrophic glutamate receptors (e.g., mGluR1, see the record for donald) to subsequently inhibit Purkinje cell dendritic growth. PMCA2 is essential for the regulation of Ca²⁺ equilibrium in dendrites and the subsequent control of dendritic growth (48). Atp2b2-deficient (Atp2b2^-/-) mice exhibited reduced levels of glutamate receptor expression as well as reduced survival of Purkinje neurons and decreased thickness of the molecular layer in the cerebellum (49;50).PMCA2 is also required for the electrical excitability of Purkinje neurons (51;52). Purkinje neurons from Atp2b2^-/- mice exhibited hyperpolarized membrane potentials, increased irregularity of spontaneous action potential firing, and sustained Ca²⁺-dependent outward potassium currents when measured by whole cell patch clamp (51). Purkinje neuron dendrites from heterozygous Atp2b2^+/- mice exhibited slower calcium recovery and subsequent weaker climbing fiber responses, sustained Ca²⁺-dependent outward potassium currents, and a slower frequency of action potential firing (53). Regulation of calcium clearance is necessary to prevent neuronal damage and loss in the spinal cord (54;55). Atp2b2 mutant mice exhibit reductions in the number of spinal cord motor neurons (54). Reduced PMCA2 promotes neuronal pathology during experimental autoimmune encephalomyelitis (EAE), a model of multiple sclerosis, and after spinal cord trauma (54;55).

PMCA2 in the mammary gland

During reproduction, the mammary gland goes through a cycle of development and regression (56). Under normal conditions, the mammary gland is a system of epithelial ducts. During pregnancy, mammary epithelial cells (MECs) proliferate to form alveoli. At parturition, secretory differentiation and milk production is induced. After weaning, the secretory cells are disposed and the gland remodeled to a duct system similar to the mature nulliparous state (56). Two rounds of apoptosis occur during the process of mammary involution. Round one is 12 to 24 hours after weaning and results in the loss of secretory epithelial cells (57;58). If the gland remains unemptied for longer than 48 hours, the second round of apoptosis occurs, resulting in irreversible tissue remodeling. After lactation, MECs undergo apoptosis and PMCA2 expression is downregulated. Reduced PMCA2 expression leads to increased levels of intracellular calcium and promotes MEC apoptosis during weaning (59). Large amounts of calcium are required for milk production (60). PMCA2 transports calcium across the apical surface of MECs into milk (61).  Atp2b2^-/- mice exhibit reduced Ca²⁺ and protein levels in milk as well as reduced milk production compared to wild-type mice (22).

Putative Mechanism

Several Atp2b2 mutant mouse models have been characterized including Atp2b2^-/- mouse models (45;62), several spontaneous mutants [wriggle mouse Sagami (wri) (43;63-65), deafwaddler (dfw), dfw^2J, dfw^3J, and dfwⁱ⁵ (23;66-68)], and several ENU-induced mutants [Atp2b2^{Deaf11/Deaf11} (46), Atp2b2^{Deaf13/Deaf13} (46), Atp2b2^Elfin/Elfin (69), Atp2b2^Obv/Obv (42), and Atp2b2^Tmy/Tmy (41)]. Homozygotes of all models exhibit variable degeneration of the organ of Corti resulting in complete deafness and vestibular defects including unsteady gaits, disturbed balance, head bobbing, and ataxia (23;41-43;45;66;67;69). Atp2b2^-/- and the ENU-induced mutant mice exhibited loss of the otoconia, crystals of calcium carbonate in the saccule and utricle of the ear important for the detection of linear acceleration and head position with respect to gravity (41;42;69). Heterozygous mice also exhibit variable hearing impairment, but do not have vestibular defects (62).Similar to the Atp2b2 mutant mouse models, the lohan mice exhibit vestibular defects, indicating that degeneration of the organ of Corti and/or loss of otoconia is occuring due to loss of PMCA2^lohan function.

Primers

PCR Primer
lohan_pcr_F: ACACTACTGCTGGCTTTGAGG
lohan_pcr_R: AGATGCTCTGGGTGAACCTC

Sequencing Primer
lohan_seq_F: ACAGGGCATGACAACTTCTG
lohan_seq_R: GTGAACCTCATCATGGACACGTTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 6, - strand):

1   agatgctctg ggtgaacctc atcatggaca cgtttgcctc cctggccctg gccacagagc
61  cacctacgga gactctgctt ctgaggaaac cgtacggtcg caacaagccg ctcatctcga
121 ggaccatgat gaagaacatc ctgggccacg ccgtctacca gctcaccctc atcttcaccc
181 tgctcttcgt gggtgagcgc cctcgtcctc acgcctctga gcttagggca ccaacttcag
241 gacataccat ggccaacaac ggctggcttt acacatgtca ttctgtttcc cccatgggga
301 aactgtggca taggagggaa atgcaggtgg cagcacacag ggagccagaa gttgtcatgc
361 cctgtccccg gctggctcac ctcaaagcca gcagtagtgt 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Kuhlbrandt, W. (2004) Biology, Structure and Mechanism of P-Type ATPases. Nat Rev Mol Cell Biol. 5, 282-295.

  3. Palmgren, M. G., and Axelsen, K. B. (1998) Evolution of P-Type ATPases. Biochim Biophys Acta. 1365, 37-45.

  4. Axelsen, K. B., and Palmgren, M. G. (1998) Evolution of Substrate Specificities in the P-Type ATPase Superfamily. J Mol Evol. 46, 84-101.

  5. Monteith, G. R., Wanigasekara, Y., and Roufogalis, B. D. (1998) The Plasma Membrane Calcium Pump, its Role and Regulation: New Complexities and Possibilities. J Pharmacol Toxicol Methods. 40, 183-190.

  6. Toyoshima, C., Nakasako, M., Nomura, H., and Ogawa, H. (2000) Crystal Structure of the Calcium Pump of Sarcoplasmic Reticulum at 2.6 A Resolution. Nature. 405, 647-655.

  7. Brini, M., and Carafoli, E. (2009) Calcium Pumps in Health and Disease. Physiol Rev. 89, 1341-1378.

  8. Carafoli, E. (2011) The Plasma Membrane Calcium Pump in the Hearing Process: Physiology and Pathology. Sci China Life Sci. 54, 686-690.

  9. Strehler, E. E., and Zacharias, D. A. (2001) Role of Alternative Splicing in Generating Isoform Diversity among Plasma Membrane Calcium Pumps. Physiol Rev. 81, 21-50.

  10. Chicka, M. C., and Strehler, E. E. (2003) Alternative Splicing of the First Intracellular Loop of Plasma Membrane Ca2+-ATPase Isoform 2 Alters its Membrane Targeting. J Biol Chem. 278, 18464-18470.

  11. Caride, A. J., Filoteo, A. G., Penheiter, A. R., Paszty, K., Enyedi, A., and Penniston, J. T. (2001) Delayed Activation of the Plasma Membrane Calcium Pump by a Sudden Increase in Ca2+: Fast Pumps Reside in Fast Cells. Cell Calcium. 30, 49-57.

  12. Elwess, N. L., Filoteo, A. G., Enyedi, A., and Penniston, J. T. (1997) Plasma Membrane Ca2+ Pump Isoforms 2a and 2b are Unusually Responsive to Calmodulin and Ca2+. J Biol Chem. 272, 17981-17986.

  13. Enyedi, A., Elwess, N. L., Filoteo, A. G., Verma, A. K., Paszty, K., and Penniston, J. T. (1997) Protein Kinase C Phosphorylates the "a" Forms of Plasma Membrane Ca2+ Pump Isoforms 2 and 3 and Prevents Binding of Calmodulin. J Biol Chem. 272, 27525-27528.

  14. Caride, A. J., Penheiter, A. R., Filoteo, A. G., Bajzer, Z., Enyedi, A., and Penniston, J. T. (2001) The Plasma Membrane Calcium Pump Displays Memory of Past Calcium Spikes. Differences between Isoforms 2b and 4b. J Biol Chem. 276, 39797-39804.

  15. Pottorf, W. J., and Thayer, S. A. (2002) Transient Rise in Intracellular Calcium Produces a Long-Lasting Increase in Plasma Membrane Calcium Pump Activity in Rat Sensory Neurons. J Neurochem. 83, 1002-1008.

  16. DeMarco, S. J., Chicka, M. C., and Strehler, E. E. (2002) Plasma Membrane Ca2+ ATPase Isoform 2b Interacts Preferentially with Na+/H+ Exchanger Regulatory Factor 2 in Apical Plasma Membranes. J Biol Chem. 277, 10506-10511.

  17. DeMarco, S. J., and Strehler, E. E. (2001) Plasma Membrane Ca2+-Atpase Isoforms 2b and 4b Interact Promiscuously and Selectively with Members of the Membrane-Associated Guanylate Kinase Family of PDZ (PSD95/Dlg/ZO-1) Domain-Containing Proteins. J Biol Chem. 276, 21594-21600.

  18. Silverstein, R. S., and Tempel, B. L. (2006) Atp2b2, Encoding Plasma Membrane Ca2+-ATPase Type 2, (PMCA2) Exhibits Tissue-Specific First Exon Usage in Hair Cells, Neurons, and Mammary Glands of Mice. Neuroscience. 141, 245-257.

  19. Grati, M., Aggarwal, N., Strehler, E. E., and Wenthold, R. J. (2006) Molecular Determinants for Differential Membrane Trafficking of PMCA1 and PMCA2 in Mammalian Hair Cells. J Cell Sci. 119, 2995-3007.

  20. Jensen, T. P., Filoteo, A. G., Knopfel, T., and Empson, R. M. (2007) Presynaptic Plasma Membrane Ca2+ ATPase Isoform 2a Regulates Excitatory Synaptic Transmission in Rat Hippocampal CA3. J Physiol. 579, 85-99.

  21. Ficarella, R., Di Leva, F., Bortolozzi, M., Ortolano, S., Donaudy, F., Petrillo, M., Melchionda, S., Lelli, A., Domi, T., Fedrizzi, L., Lim, D., Shull, G. E., Gasparini, P., Brini, M., Mammano, F., and Carafoli, E. (2007) A Functional Study of Plasma-Membrane Calcium-Pump Isoform 2 Mutants Causing Digenic Deafness. Proc Natl Acad Sci U S A. 104, 1516-1521.

  22. Reinhardt, T. A., Lippolis, J. D., Shull, G. E., and Horst, R. L. (2004) Null Mutation in the Gene Encoding Plasma Membrane Ca2+-ATPase Isoform 2 Impairs Calcium Transport into Milk. J Biol Chem. 279, 42369-42373.

  23. Street, V. A., McKee-Johnson, J. W., Fonseca, R. C., Tempel, B. L., and Noben-Trauth, K. (1998) Mutations in a Plasma Membrane Ca2+-ATPase Gene Cause Deafness in Deafwaddler Mice. Nat Genet. 19, 390-394.

  24. Post, R. L., Hegyvary, C., and Kume, S. (1972) Activation by Adenosine Triphosphate in the Phosphorylation Kinetics of Sodium and Potassium Ion Transport Adenosine Triphosphatase. J Biol Chem. 247, 6530-6540.

  25. Albers, R. W. (1967) Biochemical Aspects of Active Transport. Annu Rev Biochem. 36, 727-756.

  26. Scarborough, G. A. (2003) Why we must Move on from the E1E2 Model for the Reaction Cycle of the P-Type ATPases. J Bioenerg Biomembr. 35, 193-201.

  27. Post, R. L., and Kume, S. (1973) Evidence for an Aspartyl Phosphate Residue at the Active Site of Sodium and Potassium Ion Transport Adenosine Triphosphatase. J Biol Chem. 248, 6993-7000.

  28. Carafoli, E. (1992) The Ca2+ Pump of the Plasma Membrane. J Biol Chem. 267, 2115-2118.

  29. Stahl, W. L., Eakin, T. J., Owens, J. W.,Jr, Breininger, J. F., Filuk, P. E., and Anderson, W. R. (1992) Plasma Membrane Ca(2+)-ATPase Isoforms: Distribution of mRNAs in Rat Brain by in Situ Hybridization. Brain Res Mol Brain Res. 16, 223-231.

  30. Furuta, H., Luo, L., Hepler, K., and Ryan, A. F. (1998) Evidence for Differential Regulation of Calcium by Outer Versus Inner Hair Cells: Plasma Membrane Ca-ATPase Gene Expression. Hear Res. 123, 10-26.

  31. Dumont, R. A., Lins, U., Filoteo, A. G., Penniston, J. T., Kachar, B., and Gillespie, P. G. (2001) Plasma Membrane Ca2+-ATPase Isoform 2a is the PMCA of Hair Bundles. J Neurosci. 21, 5066-5078.

  32. Webb, S. W., Grillet, N., Andrade, L. R., Xiong, W., Swarthout, L., Della Santina, C. C., Kachar, B., and Muller, U. (2011) Regulation of PCDH15 Function in Mechanosensory Hair Cells by Alternative Splicing of the Cytoplasmic Domain. Development. 138, 1607-1617.

  33. Sakaguchi, H., Tokita, J., Muller, U., and Kachar, B. (2009) Tip Links in Hair Cells: Molecular Composition and Role in Hearing Loss. Curr Opin Otolaryngol Head Neck Surg. 17, 388-393.

  34. Etournay, R., Lepelletier, L., Boutet de Monvel, J., Michel, V., Cayet, N., Leibovici, M., Weil, D., Foucher, I., Hardelin, J. P., and Petit, C. (2010) Cochlear Outer Hair Cells Undergo an Apical Circumference Remodeling Constrained by the Hair Bundle Shape. Development. 137, 1373-1383.

  35. Assad, J. A., Shepherd, G. M., and Corey, D. P. (1991) Tip-Link Integrity and Mechanical Transduction in Vertebrate Hair Cells. Neuron. 7, 985-994.

  36. Furness, D. N., Katori, Y., Nirmal Kumar, B., and Hackney, C. M. (2008) The Dimensions and Structural Attachments of Tip Links in Mammalian Cochlear Hair Cells and the Effects of Exposure to Different Levels of Extracellular Calcium. Neuroscience. 154, 10-21.

  37. Fettiplace, R., and Hackney, C. M. (2006) The Sensory and Motor Roles of Auditory Hair Cells. Nat Rev Neurosci. 7, 19-29.

  38. Alagramam, K. N., Goodyear, R. J., Geng, R., Furness, D. N., van Aken, A. F., Marcotti, W., Kros, C. J., and Richardson, G. P. (2011) Mutations in Protocadherin 15 and Cadherin 23 Affect Tip Links and Mechanotransduction in Mammalian Sensory Hair Cells. PLoS One. 6, e19183.

  39. Lumpkin, E. A., Marquis, R. E., and Hudspeth, A. J. (1997) The Selectivity of the Hair Cell's Mechanoelectrical-Transduction Channel Promotes Ca2+ Flux at Low Ca2+ Concentrations. Proc Natl Acad Sci U S A. 94, 10997-11002.

  40. Lenzi, D., and Roberts, W. M. (1994) Calcium Signalling in Hair Cells: Multiple Roles in a Compact Cell. Curr Opin Neurobiol. 4, 496-502.

  41. Wood, J. D., Muchinsky, S. J., Filoteo, A. G., Penniston, J. T., and Tempel, B. L. (2004) Low Endolymph Calcium Concentrations in deafwaddler2J Mice Suggest that PMCA2 Contributes to Endolymph Calcium Maintenance. J Assoc Res Otolaryngol. 5, 99-110.

  42. Bortolozzi, M., Brini, M., Parkinson, N., Crispino, G., Scimemi, P., De Siati, R. D., Di Leva, F., Parker, A., Ortolano, S., Arslan, E., Brown, S. D., Carafoli, E., and Mammano, F. (2010) The Novel PMCA2 Pump Mutation Tommy Impairs Cytosolic Calcium Clearance in Hair Cells and Links to Deafness in Mice. J Biol Chem. 285, 37693-37703.

  43. Spiden, S. L., Bortolozzi, M., Di Leva, F., de Angelis, M. H., Fuchs, H., Lim, D., Ortolano, S., Ingham, N. J., Brini, M., Carafoli, E., Mammano, F., and Steel, K. P. (2008) The Novel Mouse Mutation Oblivion Inactivates the PMCA2 Pump and Causes Progressive Hearing Loss. PLoS Genet. 4, e1000238.

  44. Takahashi, K., and Kitamura, K. (1999) A Point Mutation in a Plasma Membrane Ca(2+)-ATPase Gene Causes Deafness in Wriggle Mouse Sagami. Biochem Biophys Res Commun. 261, 773-778.

  45. Tsai, H., Hardisty, R. E., Rhodes, C., Kiernan, A. E., Roby, P., Tymowska-Lalanne, Z., Mburu, P., Rastan, S., Hunter, A. J., Brown, S. D., and Steel, K. P. (2001) The Mouse Slalom Mutant Demonstrates a Role for Jagged1 in Neuroepithelial Patterning in the Organ of Corti. Hum Mol Genet. 10, 507-512.

  46. Kozel, P. J., Friedman, R. A., Erway, L. C., Yamoah, E. N., Liu, L. H., Riddle, T., Duffy, J. J., Doetschman, T., Miller, M. L., Cardell, E. L., and Shull, G. E. (1998) Balance and Hearing Deficits in Mice with a Null Mutation in the Gene Encoding Plasma Membrane Ca2+-ATPase Isoform 2. J Biol Chem. 273, 18693-18696.

  47. Carpinelli, M. R., Manning, M. G., Kile, B. T., and Burt, R. A. (2013) Two ENU-Induced Alleles of Atp2b2 Cause Deafness in Mice. PLoS One. 8, e67479.

  48. Schutz, M., Scimemi, P., Majumder, P., De Siati, R. D., Crispino, G., Rodriguez, L., Bortolozzi, M., Santarelli, R., Seydel, A., Sonntag, S., Ingham, N., Steel, K. P., Willecke, K., and Mammano, F. (2010) The Human Deafness-Associated Connexin 30 T5M Mutation Causes Mild Hearing Loss and Reduces Biochemical Coupling among Cochlear Non-Sensory Cells in Knock-in Mice. Hum Mol Genet. 19, 4759-4773.

  49. Sherkhane, P., and Kapfhammer, J. P. (2013) The Plasma Membrane Ca2+-ATPase2 (PMCA2) is Involved in the Regulation of Purkinje Cell Dendritic Growth in Cerebellar Organotypic Slice Cultures. Neural Plast. 2013, 321685.

  50. Empson, R. M., Akemann, W., and Knopfel, T. (2010) The Role of the Calcium Transporter Protein Plasma Membrane Calcium ATPase PMCA2 in Cerebellar Purkinje Neuron Function. Funct Neurol. 25, 153-158.

  51. Empson, R. M., Garside, M. L., and Knopfel, T. (2007) Plasma Membrane Ca2+ ATPase 2 Contributes to Short-Term Synapse Plasticity at the Parallel Fiber to Purkinje Neuron Synapse. J Neurosci. 27, 3753-3758.

  52. Empson, R. M., Turner, P. R., Nagaraja, R. Y., Beesley, P. W., and Knopfel, T. (2010) Reduced Expression of the Ca(2+) Transporter Protein PMCA2 Slows Ca(2+) Dynamics in Mouse Cerebellar Purkinje Neurones and Alters the Precision of Motor Coordination. J Physiol. 588, 907-922.

  53. Kurnellas, M. P., Nicot, A., Shull, G. E., and Elkabes, S. (2005) Plasma Membrane Calcium ATPase Deficiency Causes Neuronal Pathology in the Spinal Cord: A Potential Mechanism for Neurodegeneration in Multiple Sclerosis and Spinal Cord Injury. FASEB J. 19, 298-300.

  54. Nicot, A., Kurnellas, M., and Elkabes, S. (2005) Temporal Pattern of Plasma Membrane Calcium ATPase 2 Expression in the Spinal Cord Correlates with the Course of Clinical Symptoms in Two Rodent Models of Autoimmune Encephalomyelitis. Eur J Neurosci. 21, 2660-2670.

  55. Watson, C. J. (2006) Involution: Apoptosis and Tissue Remodelling that Convert the Mammary Gland from Milk Factory to a Quiescent Organ. Breast Cancer Res. 8, 203.

  56. Baxter, F. O., Neoh, K., and Tevendale, M. C. (2007) The Beginning of the End: Death Signaling in Early Involution. J Mammary Gland Biol Neoplasia. 12, 3-13.

  57. Li, M., Liu, X., Robinson, G., Bar-Peled, U., Wagner, K. U., Young, W. S., Hennighausen, L., and Furth, P. A. (1997) Mammary-Derived Signals Activate Programmed Cell Death during the First Stage of Mammary Gland Involution. Proc Natl Acad Sci U S A. 94, 3425-3430.

  58. VanHouten, J., Sullivan, C., Bazinet, C., Ryoo, T., Camp, R., Rimm, D. L., Chung, G., and Wysolmerski, J. (2010) PMCA2 Regulates Apoptosis during Mammary Gland Involution and Predicts Outcome in Breast Cancer. Proc Natl Acad Sci U S A. 107, 11405-11410.

  59. VanHouten, J. N., and Wysolmerski, J. J. (2007) Transcellular Calcium Transport in Mammary Epithelial Cells. J Mammary Gland Biol Neoplasia. 12, 223-235.

  60. VanHouten, J. N., Neville, M. C., and Wysolmerski, J. J. (2007) The Calcium-Sensing Receptor Regulates Plasma Membrane Calcium Adenosine Triphosphatase Isoform 2 Activity in Mammary Epithelial Cells: A Mechanism for Calcium-Regulated Calcium Transport into Milk. Endocrinology. 148, 5943-5954.

  61. Kozel, P. J., Davis, R. R., Krieg, E. F., Shull, G. E., and Erway, L. C. (2002) Deficiency in Plasma Membrane Calcium ATPase Isoform 2 Increases Susceptibility to Noise-Induced Hearing Loss in Mice. Hear Res. 164, 231-239.

  62. Inoue, Y., Matsumura, Y., Inoue, K., Ichikawa, R., and Takayama, C. (1993) Abnormal Synaptic Architecture in the Cerebellar Cortex of a New Dystonic Mutant Mouse, Wriggle Mouse Sagami. Neurosci Res. 16, 39-48.

  63. Takahashi, K., Osawa, N., Ohmura, M., and Kitamura, K. (1999) Evaluation of Inner Ear Histology and Auditory Brainstem Response in Wriggle Mouse Sagami. Acta Otolaryngol. 119, 767-772.

  64. Ueno, T., Kameyama, K., Hirata, M., Ogawa, M., Hatsuse, H., Takagaki, Y., Ohmura, M., Osawa, N., and Kudo, Y. (2002) A Mouse with a Point Mutation in Plasma Membrane Ca2+-ATPase Isoform 2 Gene showed the Reduced Ca2+ Influx in Cerebellar Neurons. Neurosci Res. 42, 287-297.

  65. McCullough, B. J., and Tempel, B. L. (2004) Haplo-Insufficiency Revealed in Deafwaddler Mice when Tested for Hearing Loss and Ataxia. Hear Res. 195, 90-102.

  66. Noben-Trauth, K., Zheng, Q. Y., Johnson, K. R., and Nishina, P. M. (1997) Mdfw: A Deafness Susceptibility Locus that Interacts with Deaf Waddler (Dfw). Genomics. 44, 266-272.

  67. Watson, C. J., and Tempel, B. L. (2013) A New Atp2b2 Deafwaddler Allele, Dfw(i5), Interacts Strongly with Cdh23 and Other Auditory Modifiers. Hear Res. 304, 41-48.

  68. Xu, L., Wang, Z., Xiong, X., Gu, X., Gao, X., and Gao, X. (2011) Identification of a Novel Point Mutation of Mouse Atp2b2 Induced by N-Ethyl-N-Nitrosourea Mutagenesis. Exp Anim. 60, 71-78.

  69. Fakira, A. K., Gaspers, L. D., Thomas, A. P., Li, H., Jain, M. R., and Elkabes, S. (2012) Purkinje Cell Dysfunction and Delayed Death in Plasma Membrane Calcium ATPase 2-Heterozygous Mice. Mol Cell Neurosci. 51, 22-31.

  70. Kurnellas, M. P., Lee, A. K., Li, H., Deng, L., Ehrlich, D. J., and Elkabes, S. (2007) Molecular Alterations in the Cerebellum of the Plasma Membrane Calcium ATPase 2 (PMCA2)-Null Mouse Indicate Abnormalities in Purkinje Neurons. Mol Cell Neurosci. 34, 178-188.