Phenotypic Mutation 'thistle' (pdf version)
Allelethistle
Mutation Type critical splice acceptor site
Chromosome8
Coordinate71,685,383 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Jak3
Gene Name Janus kinase 3
Synonym(s) fae; wil
Chromosomal Location 71,676,296-71,690,575 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010589; NM_001190830; MGI:99928

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000060073 ] [ENSMUSP00000105639 ] [ENSMUSP00000105640 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably null
Meta Mutation Damage Score 0.588 question?
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (DSS Female) - decreased
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1 cells - decreased
FACS CD11b+ DCs (gated in CD11c+ cells) - decreased
FACS CD11c+ DCs - increased
FACS CD4:CD8 - increased 9016869
FACS CD4+ T cells - decreased 16020505
FACS CD44+ CD4 T cells - decreased
FACS CD44+ T cells - decreased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased 16020505
FACS CD8+ T cells in CD3+ T cells - decreased 16020505
FACS CD8a+ DCs (gated in CD11c+ cells) - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM+ B cells - decreased
FACS macrophages - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS NK cells - decreased 22363534
FACS NK T cells - decreased
FACS T cells - decreased
IgG1 response to a Cysteine Protease (Papain) - decreased
impaired response to dsDNA- type I IFN production by macrophages
ratio of OVA-specific IgE over the total IgE - increased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
total IgE level - decreased
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.964
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(25) : Chemically induced (ENU)(5) Gene trapped(14) Spontaneous(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 unclassified probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
fake_news UTSW 8 71685957 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
mount_tai UTSW 8 71683377 missense probably damaging 1.00
potentes UTSW 8 71686058 missense probably damaging 0.99
thistle2 UTSW 8 71685545 missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
R7225:Jak3 UTSW 8 71685511 missense probably benign 0.07
R7440:Jak3 UTSW 8 71680718 missense probably benign 0.02
R7489:Jak3 UTSW 8 71684292 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038224-MU
Last Updated 2019-09-04 9:45 PM by Diantha La Vine
Record Created 2015-04-22 8:23 PM by Jin Huk Choi
Record Posted 2015-04-28
Phenotypic Description
Figure 1. Homozygous thistle mice exhibit a decrease in the B:T cell ratio in the peripheral blood. B and T cell frequencies were determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Homozygous thistle mice exhibit a decrease in the T cell frequency in the peripheral blood. T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Homozygous thistle mice exhibit a decrease in the B cell frequency in the peripheral blood. B cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Homozygous thistle mice exhibit a decrease in the B1 cell frequency in the peripheral blood. B1 cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Homozygous thistle mice exhibit a decrease in the IgM+ B cell frequency in the peripheral blood. IgM+ B cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Homozygous thistle mice exhibit a decrease in the percentage of IgD+ B cells in the peripheral blood. IgD+ B cell percentage was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Homozygous thistle mice exhibit an increase in the CD4+ to CD8+ T cell ratio in the peripheral blood. CD4+ and CD8+ T cell frequencies were determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Homozygous thistle mice exhibit a decreased frequency of CD4+ T cells in the peripheral blood. CD4+ T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Homozygous thistle mice exhibit a decreased frequency of naÏve CD4+ T cells in CD4+ T cells in the peripheral blood. NaÏve CD4+ T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Homozygous thistle mice exhibit a decreased frequency of CD8+ T cells in the peripheral blood. CD8+ T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Homozygous thistle mice exhibit a decreased frequency of CD8+ T cells in CD3+ T cells in the peripheral blood. CD8+ T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Homozygous thistle mice exhibit a decreased frequency of naÏve CD8+ T cells in CD8+ T cells in the peripheral blood. NaÏve CD8+ T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Homozygous thistle mice exhibit an increased frequency of effector memory CD8+ T cells in CD8+ T cells in the peripheral blood. Effector memory CD8+ T cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Homozygous thistle mice exhibit a reduced frequency of natural killer (NK) cells in the peripheral blood. NK cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Homozygous thistle mice exhibit an increased frequency of CD11c+ dendritic cells in the peripheral blood. Dendritic cell frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Homozygous thistle mice exhibit an increased frequency of macrophages in the peripheral blood. Macrophage frequency was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Homozygous thistle mice exhibit an increased CD44 mean fluorescence intensity (MFI) on T cells in the peripheral blood. CD44 MFI was determined by FACS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Homozygous thistle mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The thistle phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2058, some of which exhibited a decrease in the B:T cell ratio (Figure 1) caused by a reduced frequency of T cells (Figure 2) coupled with a greater diminution of B cells (Figure 3), B1 cells (Figure 4), IgM+ B cells (Figure 5), and IgD+ B cells (Figure 6), all in the peripheral blood. Some mice also exhibited an increase in the CD4+ to CD8+ T cell ratio (Figure 7) caused by a decreased frequency of CD4+ T cells (Figure 8) and naïve CD4+ T cells in CD4+ T cells (Figure 9) coupled with a increased diminution of the frequency of CD8+ T cells (Figure 10), a decreased frequency of CD8+ T cells in CD3+ T cells (Figure 11), a decreased frequency of naïve CD8+ T cells in CD8+ T cells (Figure 12), and an increased frequency of effector memory CD8+ T cells in CD8+ T cells (Figure 13), all in the peripheral blood. Some mice exhibited a reduced frequency of natural killer (NK) cells (Figure 14) as well as increased frequencies of CD11c+ dendritic cells (Figure 15) and macrophages (Figure 16), all in the peripheral blood. The CD44 mean fluorescence intensity (MFI) on T cells in the peripheral blood was increased in some mice (Figure 17). Some mice also exhibited a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 18).

Nature of Mutation

Figure 19. Linkage mapping of the reduced frequency of naïve CD4 T cells in CD4 T cells in the peripheral blood using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 100 mutations (X-axis) identified in the G1 male of pedigree R2058. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 100 mutations. All of the above phenotypic abnormalities were linked by continuous variable mapping to a mutation in Jak3:  an A to T transversion at base pair 71,685,383 (v38) on chromosome 8, or base pair 9,001 in the GenBank genomic region NC_000074 encoding Jak3. The strongest association was found with a recessive model of linkage to the normalized frequency of naïve CD4 T cells in CD4 T cells in the peripheral blood (P = 3.705 x 10-23), wherein 5 variant homozygotes departed phenotypically from 11 homozygous reference mice and 23 heterozygous mice (Figure 19). The mutation is located within the acceptor splice site of intron 18 (in both Jak3 protein-coding transcripts on Ensembl; both transcripts encode the same protein), two nucleotides from exon 19. The effect of the mutation at the mRNA and protein level is unknown. One possibility, shown below, is that aberrant splicing would cause skipping of the 190-base pair exon 19 (out of 25 total exons) and a frame-shift that would result in coding of 7 aberrant amino acids followed by a premature stop codon in exon 20.  

 

            <--exon 18    <--intron 18        <--exon 19-->        exon 20-->

8909 ……TCTTTGCTGGGCAAG……tcatcctcccacag GGCAACTTTGGC……AGCTATGGGCCAG GTCGCCAGAGCCTGCGGTTGGTGA

822  ……-S--L--L--G--K-                 -G--N--F--G-……-S--Y--G--P-- -V--A--R--A--C--G--W--*

          correct                               deleted                   aberrant

          

Genomic numbering corresponds to NC_000074. The acceptor splice site of intron 18, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction

Figure 20. Domain structure of JAK3. The thistle mutation destroys the acceptor splice site of intron 18. See the text for more details. Abbreviations: B41, 4.1, ezrin, radixin, moesin (FERM) homology domain; SH2, Src Homology 2-like. This image is interactive. Other mutations found in JAK3 are noted in red. Click on each mutation for more information.

Jak3 encodes Janus kinase 3 (JAK3). JAK3 has seven different highly conserved JAK homology (JH) regions (JH1-JH7) [Figure 20; reviewed in (1)]. The JH1 region is the kinase domain (amino acids 818-1091), the JH2 domain corresponds to the pseudokinase domain (amino acids 517-773), the JH3 and JH4 regions comprise an Src Homology 2 (SH2)-like domain (amino acids 370-460), and the JH6 and JH7 regions consist of a 4.1, ezrin, radixin, moesin (FERM) homology domain (alternatively, B41 domain; amino acids 20-254). The thistle mutation is predicted to result in deletion of exon 19 (which encodes amino acids 827-889), a frame-shift, and coding of a premature stop codon within the JAK3 kinase domain. Expression and localization of JAK3­citron has not been examined.

 

Please see the record mount_tai for more information about Jak3.

Putative Mechanism

JAK3 binding is restricted to hematopoietic-specific cytokine receptors that have a γc receptor subunit (i.e., the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors) [reviewed in (1)]. The γc receptor-associated cytokines have known functions. For example, IL-7 is necessary for T and B cell development, IL-2 functions in peripheral T cell homeostasis and antigen-driven T-cell expansion, IL-15 functions in natural killer (NK) cell differentiation, IL-4 functions in B-cell maturation and isotype switching (2). JAK3 mutations result in defective γc receptor-associated signaling and subsequent defects in lymphocyte development (2;3). Mutations in JAK3 are linked to autosomal recessive T- and NK-cell negative/B-cell positive type of severe combined immunodeficiency [TB+NK- SCID; OMIM: #600802; (4-6); reviewed in (2)]. Patients with TB+NK- SCID do not have T or NK cells, but have normal to elevated numbers of immature nonfunctional B lymphocytes (5;6). Patients with SCID have persistent, recurring infections due to loss of T cell-associated immunity.  Jak3 knockout (Jak3-/-) mice have reduced numbers of T, B, γδ T, and NK cells (7-11). B cell maturation in the Jak3-/- mice is blocked at the pre-B stage, leading to a reduced frequency of IgM+ B cells (10). Thistle mice exhibit reduced frequencies of T, B and NK cells as well as a reduced frequency of IgM+ B cells, indicating that JAK3thistle has loss of function.

Primers PCR Primer
thistle_pcr_F: TGATCCCCGCCCTAGATTAC
thistle_pcr_R: CCCGGTACTTGACGATGAAG

Sequencing Primer
thistle_seq_F: TAGATTACGAGCTCCTCTCAGAC
thistle_seq_R: AGTCGCTGTGCAGAGCCTTAAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 406 nucleotides is amplified (chromosome 8, + strand):


1   tgatccccgc cctagattac gagctcctct cagaccccac acctggcatc ccgagtcctc
61  gagatgagct gtgcggtggc gcccagctct atgcctgcca ggaccccgcc atattcgagg
121 agagacacct taagtacatc tctttgctgg gcaaggtgag tgggcgggca tgtgggggag
181 gaacgtgggt gggtggatgg gtcaggtgga cactgccctc tcatcctccc acagggcaac
241 tttggcagcg tggagctgtg ccgctatgac cccctggggg acaatacggg acccctggtg
301 gcagtgaaac agctacagca cagcgggcca gaccagcaga gggacttcca gcgggagatt
361 cagatcctta aggctctgca cagcgacttc atcgtcaagt accggg


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Bruce Beutler