Phenotypic Mutation 'artemis' (pdf version)
List |< first << previous [record 23 of 511] next >> last >|
Alleleartemis
Mutation Type missense
Chromosome10
Coordinate71,027,954 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Bicc1
Gene Name bicaudal C homolog 1 (Drosophila)
Synonym(s) Bic-C, jcpk
Chromosomal Location 70,922,832-71,159,700 bp (-)
MGI Phenotype Homozygous mutant mice display polycystic kidneys with distended abdomens, abnormal bile duct morphology, and die either postnatally or shortly after weaning.
Accession Number

NCBI RefSeq: NM_031397; MGI: 1933388

Mapped Yes 
Amino Acid Change Threonine changed to Isoleucine
Institutional SourceBeutler Lab
Ref Sequences
T86I in Ensembl: ENSMUSP00000014473 (fasta)
T86I in Ensembl: ENSMUSP00000123201 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using Ensembl: ENSMUSP00000014473)
Phenotypic Category homeostasis/metabolism, life span-post-weaning/aging, renal/urinary system
Penetrance 100% 
Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(1) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 0.99
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 0.99
IGL02686:Bicc1 APN 10 70943360 splice site 0.00
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.60
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense possibly damaging 0.96
R0184:Bicc1 UTSW 10 71079215 missense probably benign 0.00
R0469:Bicc1 UTSW 10 71079215 missense probably benign 0.00
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 missense probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
MMRRC Submission 030203-MU
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 08/29/2011
Phenotypic Description
The artemis phenotype was identified among ENU-mutagenized G3 mice when several animals from one pedigree were unexpectedly found dead. Upon analysis, the mice were found to have drastically enlarged kidneys. The phenotype segregated in a recessive Mendelian inheritance pattern, and was designated artemis. Artemis mice have enlarged polycystic kidneys, observable by 1 week of age. Urea levels are increased 5-fold in blood from artemis mice.
 
Homozygote artemis mice are viable but infertile. Heterozygotes are viable and fertile.

 

Nature of Mutation
The artemis mutation mapped to Chromosome 10, and corresponds to a C to T transition at position 275 of the Bicc1 transcript, in exon 3 of 21 total exons.
 
259 AAGATCATGGAGGAGACACAGATTGCA
81  -M--E--E--T--N--T--Q--I--A-
 
The mutated nucleotide is indicated in red lettering, and causes a threonine to isoleucine substitution at residue 86 of the Bicc1 protein.
Protein Prediction
Figure 1. Domain structure of Bicc1 protein products encoded by two alternatively spliced transcripts. The shorter transcript lacks exon 21, which results in deletion of 26 amino acids, including the last three residues of the SAM domain. The artemis mutation lies within the first KH domain.
Bicc1 encodes two alternatively spliced transcripts which differ by the presence or absence of the 80-nucleotide exon 21, and are predicted to result in proteins of 977 or 951 amino acids, respectively (Figure 2) (1). Bicc1 contains three predicted K homology (KH) RNA-binding domains near the N terminus, and one sterile alpha motif (SAM) protein interaction domain near the C terminus (1;2). The SAM domain in the shorter transcript is predicted to lack the last three C-terminal amino acids of the complete SAM domain consensus sequence due to alternative splicing, but whether this affects protein function is unknown (1).
 
The artemis mutation results in a threonine to isoleucine at position 86 of Bicc1, which resides in the N-terminal KH domain. This mutation is predicted to disrupt Bicc1 RNA-binding ability and/or destabilize the protein.  Protein expression levels have not been examined in artemis tissue.
Expression/Localization

Bicc1mRNA is detected in mouse embryos as soon as they have implanted, and is observed at embryonic day 13 around sites of cartilage formation, in the presumptive diaphragm, pericardium, in the mesenchyme of the developing lung, and in the mesonephros and metanephros of the developing kidney (2). Total levels of Bicc1 mRNA in whole embryos increase slightly as embryogenesis proceeds (1). In the adult mouse, Bicc1 transcripts are found at high levels in the heart and kidney, with lower levels expressed in the testis (1;2). Bicc1 mRNA can also be detected in the stroma of primary oocytes, suggesting a maternal Bicc1 contribution exists in the mouse (2), in agreement with the finding that Drosophila Bicaudal-C is a maternal effect gene (3).

 

In mouse inner medullary collecting duct cells, Bicc1 displays a diffuse cytoplasmic localization (4).

Background

bicaudal(bic) was first identified as a genetic factor affecting the anterior-posterior polarity of Drosophila embryos (5). The progeny of homozygous bic mutant female flies sometimes develop without structures from the anterior end of the embryo or with a double-abdomen, with two posterior ends arranged in mirror-image symmetry (3;5). Thus, bicaudal is a maternal effect gene with an incompletely penetrant phenotype. Subsequent genetic screening identified several new distinct loci causing similar defects in anterior-posterior patterning, one of which encoded the dominant maternal-effect mutation, Bicaudal-C (Bic-c) (3).

 

Mislocalization of pattern-determining RNAs, such as oskar (osk) and nanos (nos), during embryogenesis results in bicaudal embryos with posterior structures duplicated at their anterior ends (6;7). In progeny of Bic-C mutant females, the posterior determinant osk is mislocalized at the anterior of the embryos, suggesting that Bic-C functions to localize specific posterior RNAs during oogenesis (8). This is supported by data indicating that Bic-C protein (BIC-C) contains 5 KH domains (8) which allow it to bind RNA (9). Furthermore, at least one of its KH domains is required for its function, as a point mutation in the third KH domain causes a strong bicaudal phenotype (8). BIC-C also regulates osk translation (9).

 

The murine homologue of Bic-c (Bicc1 in mice) was identified by homology searches of cDNA sequences in GenBank (2), and later found to be the gene mutated to cause polycystic kidney disease in two mouse mutants (1). These two mouse strains have different mutant alleles of Bicc1, called jcpk and bpk. The jcpk allele was generated on a C57BL/6 background by random chlorambucil-induced mutagenesis (10;11), while the bpk allele arose spontaneously in the BALB/c strain (12). Homozygous jcpk mutants die before 10 days of age with numerous cysts in the kidneys, including in the proximal and distal tubules, collecting ducts and glomeruli (11). jcpk mutants display dilation of liver and pancreatic ducts. Approximately 30% of heterozygous jcpk mice also develop late-onset polycystic kidney disease affecting the glomeruli (11). In contrast, bpk mutants display a less severe phenotype distinct from that of jcpk mice, with polycystic kidneys that show dilation of the renal collecting ducts, and biliary dysgenesis (13;14). bpk mice live to approximately 4 weeks of age (13;14).  Mouse embryos with a targeted deficiency of Bicc1 were reported to display randomized left-right asymmetry due to disruption of the planar alignment of motile cilia of the ventral node.  Interestingly, polycystic kidney disease is also frequently linked to cilia defects, as for example in mice with mutations of Pkhd1 and inversin (15;16).

 

Autosomal recessive polycystic kidney disease (ARPKD) is an inherited disease occurring in 1 in 20,000 humans (17), characterized by dilation of renal collecting ducts, biliary dysgenesis, and portal tract fibrosis (18). The PKHD1 gene has recently been identified as the principal causative disease gene (19). Before its identification, jcpk, bpk and several other mutants have been used as models to investigate the pathogenesis of ARPKD.

Putative Mechanism

Primary apical cilia are present on epithelial cells of the nephron, biliary tract, and pancreatic ducts during adulthood (20).  The association of polycystic kidney disease with deficiencies of cilium proteins including Pkhd1, inversin, and Tg737 (21;22) in mice suggests that dysfunction of cilia may underlie cyst formation.  Although immortalized renal cells from Bicc1bpk mutants were reported to display normal ciliogenesis (23), their function was not examined.

 

Figure 2. Hypothesized role of Bicc1 in the regulation of polarity of renal epithelial cells.  Bicc1-deficient cells display aberrant localization of EGFR (from the basolateral to the apical cell membrane) and E-cadherin (from the cell membrane to the cytoplasm), conditions that may lead to impaired epithelial polarization.  Bicc1 and SamCystin were reported to interact through at least one unidentified protein and one RNA species; whether and how this complex controls EGFR and E-cadherin localization remains known.

Several reports suggest that mutations in Bicc1 cause polycystic kidneys by disrupting the normal polarity of renal epithelial cells.  In cystic renal cells immortalized from the bpk mutant mouse, epidermal growth factor receptor (EGFR) was aberrantly localized to the apical cell membrane (Figure 2), in addition to its normal presence at the basolateral membrane (23).  Abnormal EGFR sorting to the apical membrane has been observed in polycystic kidney disease caused by mutations in PKD1, PKD2, and PKHD1 (24;25).  In addition, EGFR ligands have been detected in the apical medium of cultured cystic epithelial cells and in the cyst fluid of autosomal dominant polycystic kidney disease (ADPKD) patients (26).  EGFR kinase inhibition improves kidney function in models of polycystic kidney disease (27).

 

In mouse inner medullary collecting duct cell lines in which Bicc1 was silenced by short hairpin RNA inhibition (shRNA), E-cadherin was mislocalized from cell-cell junctions to the cytoplasm (28).  Impaired cell motility, tubulogenesis, and actin cytoskeletal organization were attributed to defective E-cadherin-dependent cell-cell adhesion in these cells.  E-cadherin-mediated cell-cell adhesion triggers assembly of intercellular junctions, and is therefore essential for epithelial polarity and tubule formation.

 

The mechanism by which Bicc1 affects EGFR and E-cadherin localization remains unknown.  A report documents interaction between Bicc1 and SamCystin, another SAM-containing protein, through an unidentified RNA molecule (4).  Further studies should reveal whether the Bicc1-SamCystin complex controls EGFR and E-cadherin localization (Figure 2).

Primers Primers cannot be located by automatic search.
Genotyping
Artemis genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Bicc1(F): 5’-TCTGATGGTCCTGGCAACAAGC-3’
Bicc1(R): 5’-ACAGGTTACTGTGAAGCCCGTTATG-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 35X
6) 72°C             5:00
7) 4°C              ∞
 
Primers for sequencing
Bicc1_seq(F): 5’- TTTGAACGTGTGAAAATCTTATCTGT-3’
Bicc1_seq(R): 5’- CCAAACGTGAACAGAACTGAGCTC-3’
 
The following sequence of 618 nucleotides (from Genbank genomic region NC_000076 for linear DNA sequence of Bicc1) is amplified:
 
131345     tctgat ggtcctggca acaagctggg ttaattactt gtccatgtac tttgaggtct
131401 tgtttctgtt aagattctgg attcacggag agaacaacac agacttggat gctctcagta
131461 gattaagggc ttaggaaaac acaccccctc ttctccctcg agctttcaaa aagatgtttg
131521 cattgtttta agctgagatc atcttgttgt atcaacacaa agccagaaac atgaaaataa
131581 gaattttttt tttgaacgtg tgaaaatctt atctgtaaat acaagttctt aattgagtca
131641 atatttttct cttgatccct gactcagatc atggaggaga caaacacgca gattgcatgg
131701 ccgtccaaac tgaagatcgg ggctaaatcc aagaaaggta aatttgggac ggggagtagg
131761 tatgtttgaa aaacgagctt ccggggttgc tggagctcag ttctgttcac gtttggcctc
131821 aagtgcttgt caaatagccg tatttgggga ggattttcat gattaaaata aataggtggc
131881 tttgtggcag cagaaaaaaa aatgcttaaa aaaatagtat taaaatagaa atgttaccat
131941 aacgggcttc acagtaacct gt
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsMichael J. Barnes, Amanda L. Blasius, Bruce Beutler
List |< first << previous [record 23 of 511] next >> last >|
Edit History
08/30/2011 11:20 AM (current)
08/29/2011 6:39 PM
04/18/2011 4:35 PM
01/07/2011 8:50 AM
10/08/2010 2:21 PM
10/08/2010 2:21 PM
02/11/2010 9:42 AM