Phenotypic Mutation 'Cpg2' (pdf version)
List |< first << previous [record 80 of 511] next >> last >|
AlleleCpg2
Mutation Type missense
Chromosome9
Coordinate106,226,465 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Tlr9
Gene Name toll-like receptor 9
Chromosomal Location 106,222,598-106,226,883 bp (+)
MGI Phenotype Mice homozygous for a knock-out allele exhibit impaired immune system response to LPS, CpG, and Leishmania bazillensis infection.
Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Mapped Yes 
Amino Acid Change Glutamine changed to Leucine
Institutional SourceBeutler Lab
Ref Sequences
Q985L in Ensembl: ENSMUSP00000082207 (fasta)
Gene Model not available
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 363 386 N/A BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
Blast:LRR 471 494 N/A BLAST
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 N/A BLAST
Pfam:TIR 872 1012 1.1e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.986 (Sensitivity: 0.72; Specificity: 0.96)
(Using Ensembl: ENSMUSP00000082207)
Phenotypic Category immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 0.99
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.86
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 0.99
IGL02851:Tlr9 APN 9 106224730 nonsense probably null 0.00
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
Cpg7 UTSW 9 106225349 missense probably benign 0.01
Meager UTSW 9 106224139 missense probably damaging 1.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.02
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign 0.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.65
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 unclassified probably null
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
MMRRC Submission 030020-UCD
Last Updated 05/13/2016 3:09 PM by Peter Jurek
Record Created unknown
Record Posted 07/30/2007
Phenotypic Description
The CpG2 phenotype was identified in 2 separate screens for ENU-induced mutants with defects in the innate immune response.  In one screen, peritoneal macrophages from G3 mice were tested for the ability to produce TNF in response to treatment with various TLR ligands (TLR Signaling Screen).  CpG2 macrophages produced normal amounts of TNF in response to all TLR ligands tested, except oligodeoxynucleotides containing CpG motifs (CpG ODNs). In response to CpG-B ODN treatment, homozygous CpG2 macrophages produced reduced amounts of TNF, approximately 50% of the amount produced by C57BL/6J macrophages (Figure 1A). However, type I interferon (IFN) production by homozygous CpG2 mice was normal in response to systemic injection of CpG-A ODN (Figure 1B) (In vivo CpG Screen). In addition, Flt3-induced bone marrow-derived plasmacytoid dendritic cells produced normal amounts of type I IFN upon stimulation with CpG-A ODN (20 μg/mL) for 16 hours in vitro (Figure 1C). Heterozygous CpG2 macrophages have not been tested, and the mutation is tentatively classified as semidominant.
 
In a parallel screen, mice were tested for susceptibility to infection with a normally sublethal inoculum (1 x 105 CFU) of mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen).  While wild type mice showed no sign of sickness, homozygous CpG2 mice died within 6 days after infection (Figure 1D).
 
Among five ENU-induced TLR9 mutations identified to date (see Allelism above), the CpG2 mutation is unique in its ability to differentially affect TNF versus type I IFN production. The positions of the five mutations within TLR9 differ, with the CpG1, CpG3,and CpG5 mutations located in the eleventh, sixth, and ­­fourteenth extracellular leucine-rich repeats (LRR), respectively, and the CpG6 mutation likely located in the αE helix of the cytoplasmic Toll/IL-1R (TIR) domain. The CpG2 mutation is positioned in the αD helix of the TIR domain. In addition to CpG1, CpG2, CpG3, CpG5, and CpG6, another strain of mice, designated effete, also exhibits impaired TNF-α responses to CpG ODN treatment.  The mutant has no TLR9 mutation; the causative mutation is under investigation. 

 

Nature of Mutation
The CpG2 mutation was mapped to Chromosome 9, and corresponds to an A to T transversion at position 3060 of the Tlr9 transcript, in exon 2 of 2 total exons.
 
3044 TATGTGCGACTGCGCCAGCGTCTCTGCCGCCAG
980  -Y--V--R--L--R--Q--R--L--C--R--Q-
 
The mutated nucleotide is indicated in red lettering, and causes a glutamine to leucine substitution at residue 985 of the TLR9 protein.
Protein Prediction
Figure 3. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG2 mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The CpG2 mutation (red asterisk) results in a glutamine to leucine substitution at residue 985 of the TLR9 protein. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.
The CpG2 mutation results in a glutamine to leucine change at position 985 of the TLR9 protein, which lies in α-helix D of the TIR domain. The position of the mutation is shown within the crystal structure of the similar TLR2 TIR domain in Figure 2 (PDB ID 1FYW; see the record for languid). The mutation produces a hypomorphic allele, which may lose the ability to dimerize with TIR domains of other TLR9 subunits, or to bind downstream signaling partners.
 
Please see the record for CpG1 for information about Tlr9.

 

Putative Mechanism
The CpG2 mutation replaces a glutamine located in α-helix D of TLR9 with a leucine, and results in a hypomorphic protein with reduced responsiveness to stimulation by CpG ODN.  Structural analysis and modeling of the TIR domain of TLR2 suggest that α-helix D may lie at the predicted homodimer interface of TLRs (1).  However, the amino acid sequence identity between any pair of TIR domains is generally about 25% (2), implicating the specific sequence elements of the domain in the particular recognition of binding partners. The crystal structures of the TIR domains of TLR1, TLR2, and IL-1RAPL (IL-1R accessory protein-like) reveal that in fact, significant conformational differences exist between these molecules (2;3). Notably, α-helix D in IL-1RAP is oriented perpendicularly to that in TLR1 or TLR2 (2).
 
TLR9 α-helix D may also participate in interactions with downstream signaling molecules, and in the case of TLR9, could facilitate interactions with MyD88.  Site-directed mutagenesis and functional analysis of the TIR domain of IL-1RAcP (IL-1 receptor accessory protein) suggest that loop EE, which connects β-strand E and α-helix E, is important for IL-1 receptor complex signaling integrity, including MyD88 binding (4;5). α-helix D is only two amino acids away from β-strand E (4), and may affect the conformation of the interface that mediates binding to signaling partners. Thus, the CpG2 mutation may impair TLR9-TLR9 dimerization or interactions with cytoplasmic binding partners. The mutation does not abolish all TLR9 signaling, as TNF-α production is merely reduced and type I IFN production is largely normal. The molecular basis for the differential effect on TNF versus IFN responses is unknown.
Primers Primers cannot be located by automatic search.
Genotyping
CpG2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
CpG2(F): 5’- TAAAGGCCCTGACCAATGGCAC -3’
CpG2(R): 5’- GGCAGAGAATGAACTCCAGTCCTG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 55°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 40X
6) 72°C             7:00
7) 4°C                ∞
 
Primers for sequencing
CpG2_seq(F): 5’- GGAGCCGCAAGACTCTATTTG -3’
CpG2_seq(R): 5’- TCACTCTCCTGAAAGATGCATGG -3’
 
The following sequence of 1268 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Tlr9) is amplified:
 
 
2983                                               taaaggcc ctgaccaatg
3001 gcaccctgcc taatggcacc ctcctccaga aactcgatgt cagtagcaac agtatcgtct
3061 ctgtggtccc agccttcttc gctctggcgg tcgagctgaa agaggtcaac ctcagccaca
3121 acattctcaa gacggtggat cgctcctggt ttgggcccat tgtgatgaac ctgacagttc
3181 tagacgtgag aagcaaccct ctgcactgtg cctgtggggc agccttcgta gacttactgt
3241 tggaggtgca gaccaaggtg cctggcctgg ctaatggtgt gaagtgtggc agccccggcc
3301 agctgcaggg ccgtagcatc ttcgcgcagg acctgcggct gtgcctggat gaggtcctct
3361 cttgggactg ctttggcctt tcactcttgg ctgtggccgt gggcatggtg gtgcctatac
3421 tgcaccatct ctgcggctgg gacgtctggt actgttttca tctgtgcctg gcatggctac
3481 ctttgctagc ccgcagccga cgcagcgccc aaactctccc ttatgatgcc ttcgtggtgt
3541 tcgataaggc acagagcgca gttgccgact gggtgtataa cgagctgcgg gtgcggctgg
3601 aggagcggcg cggccgccga gccctacgct tgtgtctgga ggaccgagat tggctgcctg
3661 gccagacgct cttcgagaac ctctgggctt ccatctatgg gagccgcaag actctatttg
3721 tgctggccca cacggaccgc gtcagtggcc tcctgcgcac cagcttcctg ctggctcagc
3781 agcgcctgtt ggaagaccgc aaggacgtgg tggtgttggt gatcctgcgt ccggatgccc
3841 accgctcccg ctatgtgcga ctgcgccagc gtctctgccg ccagagtgtg ctcttctggc
3901 cccagcagcc caacgggcag gggggcttct gggcccagct gagtacagcc ctgactaggg
3961 acaaccgcca cttctataac cagaacttct gccggggacc tacagcagaa tagctcagag
4021 caacagctgg aaacagctgc atcttcatgt ctggttcccg agttgctctg cctgccttgc
4081 tctgtcttac tacaccgcta tttggcaagt gcgcaatata tgctaccaag ccaccaggcc
4141 cacggagcaa aggttggctg taaagggtag ttttcttccc atgcatcttt caggagagtg
4201 aagatagaca ccaaacccac acagaacagg actggagttc attctctgcc 
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsNengming Xiao, Carrie N. Arnold, Amanda L. Blasius, Bruce Beutler
List |< first << previous [record 80 of 511] next >> last >|
Edit History
01/07/2011 8:59 AM (current)
12/08/2010 3:31 PM
09/07/2010 12:35 PM
08/06/2010 10:05 AM
08/06/2010 10:04 AM
06/23/2010 10:58 AM
06/23/2010 10:54 AM
06/23/2010 10:54 AM
04/29/2010 11:17 AM
04/29/2010 11:15 AM
02/25/2010 2:58 PM