Phenotypic Mutation 'hubei' (pdf version)
Allelehubei
Mutation Type missense
Chromosome5
Coordinate140,892,522 bp (GRCm39)
Base Change T ⇒ C (forward strand)
Gene Card11
Gene Name caspase recruitment domain family, member 11
Synonym(s) 2410011D02Rik, BIMP3, CARMA1, 0610008L17Rik
Chromosomal Location 140,858,745-140,986,337 bp (-) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_175362; MGI:1916978

MappedYes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000082941]
AlphaFold no structure available at present
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: Y181C

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Predicted Effect probably damaging

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000085786)
Meta Mutation Damage Score 0.0656 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(11) : Chemically induced (ENU)(3) Gene trapped(1) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 intron probably benign
IGL00961:Card11 APN 5 140885464 missense probably damaging 0.97
IGL01645:Card11 APN 5 140863778 missense probably benign 0.00
IGL01731:Card11 APN 5 140868057 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140913481 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140869301 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140899133 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140892679 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140863881 missense probably benign 0.10
IGL03255:Card11 APN 5 140884086 missense possibly damaging 0.73
Ace UTSW 5 140888632 missense possibly damaging 0.70
Caravaggio UTSW 5 140899064 missense probably damaging 1.00
Dealer UTSW 5 140871632 missense probably damaging 1.00
Dogs UTSW 5 140867755 critical splice donor site probably null
Face UTSW 5 140886732 missense probably damaging 1.00
king UTSW 5 140876835 splice site probably benign
may UTSW 5 140862250 nonsense probably null
Poker UTSW 5 140863837 missense probably benign
Sharp UTSW 5 140862180 missense possibly damaging 0.93
Tumnus UTSW 5 140871700 missense possibly damaging 0.75
unmodulated2 UTSW 5 140869537 splice site probably null
PIT4243001:Card11 UTSW 5 140894359 missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140862163 missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140892415 missense probably damaging 0.99
R0046:Card11 UTSW 5 140894279 missense possibly damaging 0.92
R0285:Card11 UTSW 5 140872856 missense probably damaging 1.00
R0452:Card11 UTSW 5 140866125 missense probably benign 0.01
R1486:Card11 UTSW 5 140862274 missense probably benign
R1710:Card11 UTSW 5 140888660 nonsense probably null
R1733:Card11 UTSW 5 140892388 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140871315 missense probably benign 0.00
R1818:Card11 UTSW 5 140871315 missense probably benign 0.00
R2027:Card11 UTSW 5 140892522 missense probably damaging 0.96
R2436:Card11 UTSW 5 140868117 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140874888 missense probably benign 0.09
R3706:Card11 UTSW 5 140872890 missense probably damaging 0.99
R3708:Card11 UTSW 5 140872890 missense probably damaging 0.99
R4778:Card11 UTSW 5 140869537 splice site probably null
R4877:Card11 UTSW 5 140871632 missense probably damaging 1.00
R4889:Card11 UTSW 5 140871700 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140860169 missense probably damaging 1.00
R5011:Card11 UTSW 5 140862275 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140862180 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140862180 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140888666 nonsense probably null
R5754:Card11 UTSW 5 140885524 missense probably damaging 0.99
R5873:Card11 UTSW 5 140894393 missense probably damaging 1.00
R6184:Card11 UTSW 5 140884033 missense probably damaging 1.00
R6792:Card11 UTSW 5 140899064 missense probably damaging 1.00
R6825:Card11 UTSW 5 140863837 missense probably benign
R7008:Card11 UTSW 5 140859148 missense probably damaging 1.00
R7291:Card11 UTSW 5 140886825 missense probably damaging 1.00
R7376:Card11 UTSW 5 140883993 missense probably benign 0.01
R7526:Card11 UTSW 5 140899184 splice site probably null
R7683:Card11 UTSW 5 140881781 missense probably benign
R7730:Card11 UTSW 5 140871751 missense probably damaging 0.96
R7813:Card11 UTSW 5 140885419 missense probably damaging 1.00
R7831:Card11 UTSW 5 140859167 missense possibly damaging 0.61
R7911:Card11 UTSW 5 140867755 critical splice donor site probably null
R8154:Card11 UTSW 5 140886732 missense probably damaging 1.00
R8224:Card11 UTSW 5 140888632 missense possibly damaging 0.70
R8272:Card11 UTSW 5 140875794 missense probably damaging 1.00
R8714:Card11 UTSW 5 140899147 missense possibly damaging 0.67
R8715:Card11 UTSW 5 140871315 missense probably benign 0.00
R9065:Card11 UTSW 5 140894297 missense probably damaging 1.00
R9211:Card11 UTSW 5 140869375 missense probably benign 0.16
R9215:Card11 UTSW 5 140866154 missense possibly damaging 0.64
R9269:Card11 UTSW 5 140892516 missense probably damaging 0.99
R9385:Card11 UTSW 5 140871276 missense probably benign 0.44
R9421:Card11 UTSW 5 140869462 missense probably damaging 0.97
R9424:Card11 UTSW 5 140894395 missense probably damaging 1.00
R9444:Card11 UTSW 5 140894393 missense probably damaging 1.00
V7732:Card11 UTSW 5 140862250 nonsense probably null
X0067:Card11 UTSW 5 140871347 missense possibly damaging 0.60
Z1177:Card11 UTSW 5 140883996 missense probably benign 0.43
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 038199-MU
Last Updated 2019-09-04 9:45 PM by Diantha La Vine
Record Created 2015-05-16 9:00 PM by Ming Zeng
Record Posted 2017-08-18
Phenotypic Description

Figure 1. Hubei mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hubei phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2027, some of which exhibited increased frequencies of B1a cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased peripheral B1a cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 77 mutations (X-axis) identified in the G1 male of pedigree R2027. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 77 mutations. The increased B1a cell frequency in the peripheral blood was linked to a mutation in Card11:  an A to G transition at base pair 140,906,767 (v38) on chromosome 5, or base pair 93,830 in the GenBank genomic region NC_000071. Linkage was found with a recessive model of inheritance (P = 4.116 x 10-7), wherein 3 variant homozygotes departed phenotypically from 13 homozygous reference mice and 11 heterozygous mice (Figure 2).  A substantial semidominant effect was observed, but the mutation is preponderantly recessive. 

The mutation corresponds to residue 863 in the mRNA sequence NM_175362 within exon 5 of 25 total exons.

847 TTCCAGGAGCGATACTACAAGATGAAGGAGGAG

176 -F--Q--E--R--Y--Y--K--M--K--E--E-

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at position 181 (Y181C) in the CARMA1/CARD11 (hereafter CARMA1) protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.976) (1).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain structure of CARMA1. The hubei mutation results in a tyrosine to cysteine  substitution at position 181 within the coiled-coil domain. Four predicted α-helices are represented in pink. This image is interactive. Other mutations found in CARMA1 are noted. Click on each mututation for more specific information.

CARMA1 contains no catalytic domains, but several protein interaction domains [Figure 3; reviewed in (2)]. The N-terminal half of CARMA1 contains a caspase recruitment domain (CARD) (residues 19-105) and a coiled-coil domain (residues 116-439). A membrane-associated guanylate kinase (MAGUK) domain occupies the bulk of the C-terminal half of CARMA1 (3;4). MAGUK family proteins contain 3 modular protein interaction domains, of which the hallmark is an approximately 300 amino acid region with homology to yeast guanylate kinase (GUK), but which is catalytically inactive. In addition, up to three PDZ domains and an SH3 domain are always present in tandem with the guanylate kinase domain. CARMA1 contains one PDZ (residues 660-742), one SH3 (residues 766-834) and one GUK domain (residues 954-1142) (3;4). The N- and C-terminal halves of CARMA1 are connected by a region of 232 amino acids between the CARD and coiled-coil domains designated the linker domain (residues 440-671). A NORS (no regular secondary structure) subdomain is found at the N-terminus of the linker domain (residues 44-519). The hubei mutation results in a tyrosine to cysteine substitution at position 181 of CARMA1, which is within the coiled-coil domain. Coiled-coil domains function as protein oligomerization domains, and CARMA1 is constitutively oligomerized and localized within the cell via the coiled-coil domain (5). Expression, dimerization, localization, and function of CARMA1hubei have not been examined.

Please see the record for king for more information about Card11.

Putative Mechanism

CARMA1 belongs to the membrane-associated guanylate kinase (MAGUK) protein family, whose members function as molecular scaffolds for the localized assembly of such multiprotein complexes [reviewed in (6)]. Upon T cell activation by the T cell receptor (TCR) and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; also known as MLT or Paracaspase) and recruits these proteins to lipid rafts of the immunological synapse, where they activate the IKK complex, leading to degradation of IκB and subsequent activation of NF-κB (7-10). The CARMA1/Bcl10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (11). NF-κB controls the proliferation, differentiation and survival of B and T cells by activating the transcription of target genes, including various cytokines.

CARMA1 mutants have normal numbers and differentiation of B cells in the bone marrow, but IgDhighIgMlow splenocytes and serum immunoglobulins (IgM, IgG1, IgG2a, IgG2b, IgG3, and IgA) are reduced in CARMA1 mutants. Peritoneal CD5+ B1 B cells are absent, and NK cells are reduced in number in CARMA1 mutant mice. CARMA1 mutant B cells fail to proliferate in response to BCR stimulation with anti-IgM, or upon CD40 stimulation. T cell development is largely normal in CARMA1 mutants, which have normal numbers of single- and double-positive thymocytes. However, within the double negative (CD4-CD8-) compartment, the proportion of DN3 cells (CD25+CD44lo) is reduced, while that of DN4 cells (CD25-CD44lo) is increased. Activating mutations in CARD11 (e.g., Gly123Asp, Glu127Gly, and Gly116Ser) have been linked to a disorder in humans associated with persisten polyclonal B cell lymphocytosis [PPBL; OMIM: #606445; (12;13). PPBL is also often referred to as B cell expansion with NF-κB and T-cell anergy (BENTA). PPBL onset occurs in infancy with patients exhibiting splenomegaly and polyclonal expansion of B cells, subsequently leading to peripheral lymphocytosis (13). PPBL patients may also exhibit mild immune dysfunction (e.g., defective antibody responses and T cell anergy) as well as the development of B cell malignancy (13). Patients with B cell lymphocytosis exhibit high expression of cell cycle progression genes as well as increased proliferation and improved B cell survival after BCR stimulation (12). Tyr181, affected in hubei, is in close proximity to amino acids that have been documented to cause PPBL in humans; therefore, the hubei mutation may be an activating mutation that results in increased B1a cell frequency in the peripheral blood.

Primers PCR Primer
hubei_pcr_F: TATCTGCATGTGCCCCTCTAGG
hubei_pcr_R: ATGAGGGCCTCACACACTTC

Sequencing Primer
hubei_seq_F: AGAGCCCCCAGACATTTCTTTTC
hubei_seq_R: ACTTCCTGATGAACGAGGTCATC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 400 nucleotides is amplified (chromosome 5, - strand):


1   atgagggcct cacacacttc ctgatgaacg aggtcatcaa actgcagcag caagtgaaag
61  ccaaggacct tcagcgctgt gagctgctgg ccaagtcccg gcaactggag gatgagaaga
121 agcagctgag cctgatacgg gtggagctgc tgaccttcca ggagcgatac tacaagatga
181 aggaggagcg ggacagctac aatgacgagc tcgtcaaggt caaggacgac aactacaact
241 tagccatgcg ctacgcccag ctcagtgagg agaaaaacat ggcggtgatg aggagccgcg
301 acctccaact cgaggtgggg atgcctgggc tccggctgaa ctgagggaag ggaaaagaaa
361 tgtctggggg ctctggcccc tagaggggca catgcagata 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Xue Zhong, Bruce Beutler