Phenotypic Mutation 'flake'

• Allele: flake
• Mutation Type: missense
• Chromosome: 19
• Coordinate: 44,388,769 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Scd1
• Gene Name: stearoyl-Coenzyme A desaturase 1
• Synonym(s): SCD, stearoyl-CoA desaturase, Scd-1
• Chromosomal Location: 44,382,889-44,396,148 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in fatty acid biosynthesis, primarily the synthesis of oleic acid. The protein belongs to the fatty acid desaturase family and is an integral membrane protein located in the endoplasmic reticulum. Transcripts of approximately 3.9 and 5.2 kb, differing only by alternative polyadenlyation signals, have been detected. A gene encoding a similar enzyme is located on chromosome 4 and a pseudogene of this gene is located on chromosome 17. [provided by RefSeq, Sep 2015] ; PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit alopecia, scaly skin, sebaceous gland hypoplasia, impaired ocular lubrication and synthesis and storage of triglycerides, higher lipid oxidation, reduced growth, and lower fertility in females. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P13516
• SMART Domains: Protein: ENSMUSP00000036936; Gene: ENSMUSG00000037071; AA Change: T227K

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
transmembrane domain	67	89	N/A	INTRINSIC
Pfam:FA_desaturase	93	313	2.4e-17	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000041331)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably essential (E-score: 0.949)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, gDNA
• MMRRC Submission: 010467-UCD
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2007-07-11
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Philippe Georgel, Karine Crozat, Bruce Beutler

Accession Number

NCBI RefSeq: BC055453; MGI: 98239

Alleles Listed at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Spontaneous(4) Chemically induced(1)

Phenotypic Description

The flake phenotype was identified as a visible phenotype among G3 mice mutagenized with ENU (1). At weaning age, flake mice develop alopecia and chronic exfoliative dermatitis that progress with age (Figure 1). Disruption of epidermal integrity is observed in flake mice. Flake hairs are short and rough.  Mutants have small eyes with excessive excretion.

 

The cholesterol ester content of flake skin lipid extracts is reduced compared to wild type, and flake sebaceous glands atrophy abnormally.

 

Flake mice displayed increased susceptibility to subcutaneous infection with gram-positive (Streptococcus pyogenes and Staphylococcus aureus), but not gram-negative (E. coli) bacteria.  When wild type mice were clear of cutaneous bacteria at 8 days post-infection with S. pyogenes, flake skin still contained bacteria at levels near the amount of the initial inoculum.  Flake mice had normal resistance to gram-positive bacteria when introduced intravenously or intratracheally.  Intradermal injection of palmitoleate every other day for 9 days after infection with S. aureus resulted in a 90% reduction in cutaneous S. aureus in wild type mice, but in flake mice, bacterial growth was only reduced during days 1 to 4 post-infection, and S. aureus was still present in flake skin 2 weeks after inoculation.  However, such intradermal palmitoleate injections significantly reduced lesion size in flake mice, similar to that observed in wild type mice..

 

Scd1 transcription is upregulated in response to S. aureus infection in wild type, but not in Tlr2^-/- mice, indicating that this upregulation is TLR2-dependent. Treatment of peritoneal macrophages with MALP-2, a TLR-2 agonist, increased in Scd1 expression. MALP-2, but not LPS (a TLR4 agonist) treatment of the human sebocyte cell line, SZ95, induced IL-6 and IL-8 production.

Nature of Mutation

The flake mutation was mapped to Chromosome 19, and corresponds to a C to A transversion at position 938 of the Scd1 transcript, in exon 5 of 6 total exons.

 

922 TGCTTCATCCTGCCCACGCTGGTGCCCTGGTAC

222 -C--F--I--L--P--T--L--V--P--W--Y-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of threonine to lysine at residue 227 of the SCD1 protein.

Protein Prediction

Figure 2. Domain structure of the SCD-1 protein. The flake mutation results in a threonine to lysine substitution at amino acid 227.

Scd1 encodes stearoyl-Coenzyme A desaturase 1 (SCD1), the rate-limiting enzyme responsible for de novo synthesis of monounsaturated fatty acids from saturated fatty acids (2).  SCD-1 is an iron-containing protein with four transmembrane domains and three loops connecting the membrane-spanning domains (3;4) (Figure 2).  SCD1 is anchored in the endoplasmic reticulum, with both the N and C termini oriented toward the cytosol (4).  Three histidine box motifs present on the cytosolic side are essential for SCD1 catalytic function (4;5).  SCD1 is not a thiol enzyme, and does not require its five cysteine residues (positions 92, 97, 222, 233, 322) for catalytic activity, as previously thought (4).  The flake mutation is a threonine to lysine missense mutation at position 227, in the third transmembrane domain.  The mutation results in a hypomorphic allele, possibly destabilizing the normal protein conformation.

Expression/Localization

SCD1 is expressed in liver, adipose tissue, eyelid, and in undifferentiated sebocytes of the skin (2). SCD1 is anchored in the endoplasmic reticulum.

Background

Figure 3. SCD1 is an ER enzyme that, along with NADH, cytochrome b 5 reductase, cytochrome b 5 and O 2 , catalyzes the biosynthesis of the monounsaturated fatty acids found in various lipids.

SCD1 catalyzes the insertion of the cis double bond at the D9 position of long-chain saturated fatty acyl-CoAs. SCD1 functions together with cytochrome b5 reductase, cytochrome b5, and NADH, acting on its preferred substrates palmitoyl (C_16:0)-CoA and stearoyl (C_18:0)-CoA to produce palmitoleoyl (C_16:1)-CoA and oleoyl (C_18:1)-CoA, respectively (2) (Figure 3).  SCD1 plays a significant role in lipid metabolism, as palmitoleoyl-CoA and oleoyl-CoA are major substrates for the synthesis of triglycerides, wax esters, cholesterol esters and membrane phospholipids (2).  By regulating these products, SCD1 affects the ratio of stearic acid to oleic acid, a determinant of membrane fluidity.

 

Three spontaneous mutant alleles of Scd1, designated asebia, asebia-J and asebia-2j (hereafter referenced collectively as “asebia”), exist in mice, and homozygosity for any of these alleles results in alopecia, atrophic sebaceous glands, and scaly skin, as well as narrow eye fissures (6;7).  A targeted SCD1-null mouse also displays the same phenotypes (8).  Histological analysis of Scd1 mutant mice revealed a thickened epidermis with large intracellular spaces, and abnormal sebaceous cell differentiation (7;8). Fewer lipid droplets and distorted smooth endoplasmic reticula were observed in Scd1 mutant skin.  Lipid analysis of extracts from asebia and Scd1^-/- skin or eyelids revealed reduced levels of triglycerides, cholesterol esters and wax esters compared to wild type (7;8).

 

Figure 4. Role of SCD1 deficiency on lipid metabolism in liver, muscle, and brown adipose tissue. Figure modified from ( 9 ).

The signaling pathways in which SCD1 participates have been most studied in relation to their effect on obesity (Figure 4) [reviewed in (9)].  Scd1^-/- mice are lean, protected from leptin deficiency-induced (see Business class, Cherub, and Southbeach) and diet-induced obesity, and have increased energy expenditure and greater whole-body insulin sensitivity (10-12).  Basal tyrosine phosphorylation of the insulin receptor (IR) and insulin receptor substrates (IRS)-1 and 2 is elevated, while the protein level and activity of protein tyrosine phosphatase 1B (PTP-1B), a negative regulator of insulin signaling, is reduced in Scd1^-/- muscle tissue (12).  Lipid metabolism in the liver is also affected by SCD1 deficiency, resulting in activation of AMP-activated protein kinase (AMPK) (13), which serves to negatively regulate fatty acid synthesis, and downregulation of sterol regulatory binding protein 1c (SREBP-1c) (14), a lipogenic transcription factor.

Putative Mechanism

Together with the epidermis and hair follicles, sebaceous glands form part of the body’s skin, which provides a protective barrier against microbes while keeping in essential body fluids.  Sebaceous glands are an appendage of the hair follicle, and generate sebocytes, which produce lipids and sebum.  These sebocytes release lubricating lipid complexes containing wax esters, triglycerides and cholesterol esters when they disintegrate, providing protection against bacterial infections and preventing moisture evaporation.

 

Several proteins are known to control sebocyte homeostasis and function [reviewed in (15)], but little is known about how SCD1 interfaces with these molecules in sebocytes.  However, one link may be through peroxisome proliferator-activated receptor (PPAR)-γ. A recent report demonstrated that PPAR-γ positively regulates SCD1 expression in vascular endothelial cells during shear stress (16).  PPAR-γ is believed to contribute to sebocyte differentiation and lipid production as an adipogenic transcription factor expressed in differentiating sebocytes (17).  PPAR-γ-null embryonic stem cells contribute poorly to sebaceous gland development in mice (18).  Thus, PPAR-γ may signal through SCD1 to maintain sebocyte homeostasis.  This is further supported by a study demonstrating that SCD1 deficiency attenuates fasting-induced liver steatosis in PPAR-α-deficient mice (19).

 

No other studies document a role for SCD1 in the innate immune response. However, given the role of SCD1 in maintaining sebaceous glands and overall skin integrity, it is not surprising that SCD1 is involved in the skin’s defense against microbes.  In support of this, palmitoleic acid has been shown to inhibit the growth of gram-positive bacteria in culture (20).  Dermal infiltrates from asebia mice were shown to be rich in mast cells and macrophages (21).  During infection and wound response, epidermal cells regulate cell polarity, movement and adhesion via the RhoGTPases, p120-catenin and α-catenin, which affect the transcriptional status of NF-κB, and in turn cytokine production (22;23).  The Scd1 promoter region contains several NF-κB binding sites (1), suggesting that the TLR2-dependent innate response involves regulation of lipid composition through transcriptional control of Scd1.

Primers

Primers cannot be located by automatic search.

Genotyping

Flake genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Flake(F): 5’-CCGAGAGACTAAGGGATTCTTATGGTTCCGTG -3’

Flake(R): 5’- GGACTCAGAGGCTCATTATAGGCAGCATTTAGAC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:20

4) 68°C             4:00

5) repeat steps (2-4) 35X

6) 68°C             5:00

7) 4°C              ∞

 

Primers for sequencing

Flake_seq(F): 5’- ACAGTTCGTGTAGGTTTGAGAGTCCTCTATC -3’

Flake_seq(R): 5’- CCTCCTGGTTCCTCTGGTTCCTAAACAAAC -3’

 

The following sequence of 3566 nucleotides (from Genbank genomic region NC_000085 for linear DNA sequence of Scd1) is amplified:

 

4113                                    ccgagaga ctaagggatt cttatggttc

4141 cgtgaaaaac agaccctcac cccaaaacca aagaacactg gcatcaggga aggcgccttg

4201 gcaacttcca ctactgaaat ttgcctgttg gtgagtctcc cactgtcttg tcttgcaggg

4261 attttctact acatgaccag cgctctgggc atcacagccg gggctcatcg cctctggagc

4321 cacagaactt acaaggcacg gctgcccctg cggatcttcc ttatcattgc caacaccatg

4381 gcgttccagg taagaagcga gtgctgtggc tgtgtctcca tccccaggat gatctgagtg

4441 agccgtgggg gatcagcatc tagggaggaa ttataaggac caccactgac tgcctttttt

4501 tggtgtcctg gactcatctc aagtaaaaca ggttcaggac cgatatcgta tctcacagtg

561  tgtttgccta aagggccctg ctgcaggatc catgcactga ccctgggttc ctgagctctt

4621 actggagagt caactcatac tttcctgtga ccatcatgga atgtcaccac aatgggacta

4681 acagtgatat gtcacgtaat tgggaattct attggctgtg ctgggcactt gtcataagtt

4741 aacacattaa gtcctcatag acatattggt gggtattatc attatcacac ttatttttat

4801 tctctgacat aagatctcac tgagtagcca tggctggcct ggaactcact atgtagatca

4861 ggctggcctc tgccttcaca gtactgggat taaaggtgcg ctttagtcgg gcgtggtggc

4921 gcatgccttt aatcccagca cttgggatta aagtgagttc caggacagcc agggctacac

4981 agagaaaccc tgttacccac cacttaactg actctgaaag gttggcctgg tgacccatgt

5041 tcttgcagag actgctgggt tagctaggtc aggtatgaaa gttgacttat agttaaatga

5101 ggagagttgg gggaattttt agttgttggg cactggatga ctttcgaagg ctttctcttc

5161 atacaagaga aaaatcagga tccaaattat tcccatttat tgacaatatg tcaaaagagt

5221 ttcccgtatg ccccggagga gctcagaggt cccatggaaa tgggctcatg ctcattaatt

5281 acgtgctggc ttaaaattag gttgggtggg ctgtcacctg tgaaagcatc tgggtgggac

5341 tccctgcatc tttccccgga ctccctgggg tccacctgcc ttaggatctc tgcccccagg

5401 ttcccacatt cctttcttca agaactgcag cgttctttgt gagagctgtg actttcctcc

5461 ccgcctcctc acacacaacc ttcagtgtgc tctgagactt tgccaaataa gctccaggga

5521 caaaggtaca aaagagcagc ccccaaggtc tcctttggag ctacagccct aggggcttag

5581 agttctctta ggcactggat tacctcagga gagcctctct tctcaatact gggttcctct

5641 ttcctgtgct tccagaatga cgtgtacgaa tgggcccgag atcaccgcgc ccaccacaag

5701 ttctcagaaa cacacgccga ccctcacaat tcccgccgtg gcttcttctt ctctcacgtg

5761 ggttggctgc ttgtgcgcaa acacccggct gtcaaagaga agggcggaaa actggacatg

5821 tctgacctga aagccgagaa gctggtgatg ttccagagga ggtaagggat ggggtggggg

5881 tggaacccag ggcacctggg gtttagggat tccacatttt ctcttaggat gtataaaata

5941 ataattaagg tgatttactg gatcgataag cttgaaatca ctaaagtctc caattcaaca

6001 tcccataggt tcccaaggca taatgtttct gcctgagcca tcctgctaaa accaataact

6061 ataacattgg tcctagtctg gtactcatgg ctgagcggtt taccttcaag gaattttcag

6121 ggtatttggg gttgaaggaa tgagccttaa ttagctccac ataaagcagg atggtgcctg

6181 cttaccatga ttaaggagga ggagatacag ctcggtggat gcacaatgta actagtgcag

6241 tagcgtcagg atccaaccaa cacagaggct ctggcagtgt ggtgggcagg gactgcaatg

6301 gaatgtcaag acatgctcct ttctggcata gtccttctct gtgagatgta ccgtgtgaca

6361 ggagccaggc tgccaggaca gacagagtca gtattgattc agtcagtttc aggggactaa

6421 ctcaagcaaa cattctctgg cagccgtggg acacggcttt caagataggt gaaagtagtg

6481 atggagctag ggagataaca gccagagtca caggttagac cagcaggagg cttcagctag

6541 ggaagtagtg agcagatgga caggaacgac gccaagggag tctcagtgat acaactgctg

6601 agggatgtcc tcggcctggt ttatagggat tgaagaatgg gacagggctg ctagagtgac

6661 agaaacctgc agaagatcaa ggacatttga tgtgtcttct gggcgggggt ggggggtggg

6721 gggtgagcag aacagagacc cacagggtga tgggaagtga aggcatgaca cttgccttac

6781 tctgccaaaa acctcaacgg gcaagaagga gctcaaaggc tgatggagaa cagcccagga

6841 agcagaattg gcaagtgagg ttgtgatttg attcccaact ggtttgacga gcaggacctt

6901 atgttcctat gaaaaaaagt aatggctttg tagtcaggaa tagaagtgac aggagacaaa

6961 ctatacccag tgggatccta gaagaatatt ggcacatttg tgtatcccat ccaaagaaag

7021 agaacaccat gcttaagatt ttgttatcac ctttcctctg gctgatagtc tgtcccatcc

7081 cttgacgtaa aaatgataca acgctgccta attagggggg gacagttcgt gtaggtttga

7141 gagtcctcta tccagactct gtgtgatctc tccatgtagg tactacaagc ccggcctcct

7201 gctgatgtgc ttcatcctgc ccacgctggt gccctggtac tgctggggcg agacttttgt

7261 aaacagcctg ttcgttagca ccttcttgcg atacactctg gtgctcaacg ccacctggct

7321 ggtgaacagt gccgcgcatc tctatggata tcgcccctac gacaagaaca ttcaatcccg

7381 ggagaatatc ctggtttccc tgggtgccgt gggtaagtca ctagtccccg acaggaccgt

7441 atctaggggc cttccggttg tgttgtttgt ttaggaacca gaggaaccag gaggacctgt

7501 tttgtgagtt ctgtgtagtt cggtttttcc accataaaac tgggggttgg ggagagtata

7561 ttggaggcct tacgagtgtc tggtaagcaa cagctcttaa tgtaaaaagg aaaggggaag

7621 aaggcttata ggttgtaaaa caatgtctaa atgctgccta taatgagcct ctgagtcc

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.

References

  1.  Georgel, P., Crozat, K., Lauth, X., Makrantonaki, E., Seltmann, H., Sovath, S., Hoebe, K., Du, X., Rutschmann, S., Jiang, Z., Bigby, T., Nizet, V., Zouboulis, C. C., and Beutler, B. (2005) A toll-like receptor 2-responsive lipid effector pathway protects mammals against skin infections with gram-positive bacteria, Infect. Immun. 73, 4512-4521.

   2.  Miyazaki, M. and Ntambi, J. M. (2003) Role of stearoyl-coenzyme A desaturase in lipid metabolism, Prostaglandins Leukot. Essent. Fatty Acids 68, 113-121.

   3.  Stukey, J. E., McDonough, V. M., and Martin, C. E. (1990) The OLE1 gene of Saccharomyces cerevisiae encodes the delta 9 fatty acid desaturase and can be functionally replaced by the rat stearoyl-CoA desaturase gene, J. Biol. Chem. 265, 20144-20149.

   4.  Man, W. C., Miyazaki, M., Chu, K., and Ntambi, J. M. (2006) Membrane topology of mouse stearoyl-CoA desaturase 1, J. Biol. Chem. 281, 1251-1260.

   5.  Fox, B. G., Shanklin, J., Somerville, C., and Munck, E. (1993) Stearoyl-acyl carrier protein delta 9 desaturase from Ricinus communis is a diiron-oxo protein, Proc. Natl. Acad. Sci. U. S. A 90, 2486-2490.

   6.  Zheng, Y., Eilertsen, K. J., Ge, L., Zhang, L., Sundberg, J. P., Prouty, S. M., Stenn, K. S., and Parimoo, S. (1999) Scd1 is expressed in sebaceous glands and is disrupted in the asebia mouse
3, Nat. Genet. 23, 268-270.

   7.  Sundberg, J. P., Boggess, D., Sundberg, B. A., Eilertsen, K., Parimoo, S., Filippi, M., and Stenn, K. (2000) Asebia-2J (Scd1(ab2J)): a new allele and a model for scarring alopecia
5, Am. J Pathol. 156, 2067-2075.

   8.  Miyazaki, M., Man, W. C., and Ntambi, J. M. (2001) Targeted disruption of stearoyl-CoA desaturase1 gene in mice causes atrophy of sebaceous and meibomian glands and depletion of wax esters in the eyelid, J. Nutr. 131, 2260-2268.

   9.  Dobrzyn, A. and Ntambi, J. M. (2005) The role of stearoyl-CoA desaturase in the control of metabolism, Prostaglandins Leukot. Essent. Fatty Acids 73, 35-41.

 10.  Cohen, P., Miyazaki, M., Socci, N. D., Hagge-Greenberg, A., Liedtke, W., Soukas, A. A., Sharma, R., Hudgins, L. C., Ntambi, J. M., and Friedman, J. M. (2002) Role for stearoyl-CoA desaturase-1 in leptin-mediated weight loss 3, Science 297, 240-243.

 11.  Ntambi, J. M., Miyazaki, M., Stoehr, J. P., Lan, H., Kendziorski, C. M., Yandell, B. S., Song, Y., Cohen, P., Friedman, J. M., and Attie, A. D. (2002) Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity, Proc. Natl. Acad. Sci. U. S. A 99, 11482-11486.

 12.  Rahman, S. M., Dobrzyn, A., Dobrzyn, P., Lee, S. H., Miyazaki, M., and Ntambi, J. M. (2003) Stearoyl-CoA desaturase 1 deficiency elevates insulin-signaling components and down-regulates protein-tyrosine phosphatase 1B in muscle, Proc. Natl. Acad. Sci. U. S. A 100, 11110-11115.

 13.  Dobrzyn, P., Dobrzyn, A., Miyazaki, M., Cohen, P., Asilmaz, E., Hardie, D. G., Friedman, J. M., and Ntambi, J. M. (2004) Stearoyl-CoA desaturase 1 deficiency increases fatty acid oxidation by activating AMP-activated protein kinase in liver, Proc. Natl. Acad. Sci. U. S. A 101, 6409-6414.

 14.  Miyazaki, M., Kim, Y. C., and Ntambi, J. M. (2001) A lipogenic diet in mice with a disruption of the stearoyl-CoA desaturase 1 gene reveals a stringent requirement of endogenous monounsaturated fatty acids for triglyceride synthesis, J. Lipid Res. 42, 1018-1024.

 15.  Fuchs, E. (2007) Scratching the surface of skin development, Nature 445, 834-842.

 16.  Qin, X., Tian, J., Zhang, P., Fan, Y., Chen, L., Guan, Y., Fu, Y., Zhu, Y., Chien, S., and Wang, N. (2007) Laminar shear stress up-regulates the expression of stearoyl-CoA desaturase-1 in vascular endothelial cells, Cardiovasc. Res. 74, 506-514.

 17.  Rosenfield, R. L., Deplewski, D., Kentsis, A., and Ciletti, N. (1998) Mechanisms of androgen induction of sebocyte differentiation, Dermatology 196, 43-46.

 18.  Rosen, E. D., Sarraf, P., Troy, A. E., Bradwin, G., Moore, K., Milstone, D. S., Spiegelman, B. M., and Mortensen, R. M. (1999) PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro, Mol. Cell 4, 611-617.

 19.  Miyazaki, M., Dobrzyn, A., Sampath, H., Lee, S. H., Man, W. C., Chu, K., Peters, J. M., Gonzalez, F. J., and Ntambi, J. M. (2004) Reduced adiposity and liver steatosis by stearoyl-CoA desaturase deficiency are independent of peroxisome proliferator-activated receptor-alpha, J. Biol. Chem. 279, 35017-35024.

 20.  Wille, J. J. and Kydonieus, A. (2003) Palmitoleic acid isomer (C16:1delta6) in human skin sebum is effective against gram-positive bacteria, Skin Pharmacol. Appl. Skin Physiol 16, 176-187.

 21.  Brown, W. R. and Hardy, M. H. (1989) Mast cells in asebia mouse skin, J. Invest Dermatol. 93, 708.

 22.  Perez-Moreno, M., Davis, M. A., Wong, E., Pasolli, H. A., Reynolds, A. B., and Fuchs, E. (2006) p120-catenin mediates inflammatory responses in the skin, Cell 124, 631-644.

 23.  Kobielak, A. and Fuchs, E. (2006) Links between alpha-catenin, NF-kappaB, and squamous cell carcinoma in skin, Proc. Natl. Acad. Sci. U. S. A 103, 2322-2327.