Phenotypic Mutation 'Inwood'

• Allele: Inwood
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 74,752,625 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Nlrc4
• Gene Name: NLR family, CARD domain containing 4
• Synonym(s): 9530011P19Rik, Card12, Ipaf
• Chromosomal Location: 74,733,254-74,766,140 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014] ; PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]
• Mapped: No
• Amino Acid Change: Isoleucine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000059637]
• AlphaFold: Q3UP24
• PDB Structure: Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000059637; Gene: ENSMUSG00000039193; AA Change: I586T

Domain	Start	End	E-Value	Type
Pfam:CARD	1	87	1.4e-20	PFAM
Pfam:NACHT	163	314	1.3e-28	PFAM
SCOP:d1yrga_	734	1015	3e-20	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000052124)
• Meta Mutation Damage Score: 0.5926
• Is this an essential gene?: Probably nonessential (E-score: 0.151)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• MMRRC Submission: 038229-MU
• Last Updated: 2019-10-23 1:57 PM by Peter Jurek
• Record Created: 2015-05-25 12:56 AM by Hexin Shi
• Record Posted: 2015-11-10
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Bruce Beutler, Hexin Shi, Ying Wang, Zhao Zhang, Doan Dao, Lei Sun

Accession Number

NCBI RefSeq: NM_001033367; MGI:3036243

Alleles Listed at MGI

All mutations/alleles(24) : Gene trapped(18) Targeted(6)

Phenotypic Description

Figure 1. Inw ood mice exhibited decreased IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by flagellin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The inwood phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2256, some of which showed exhibited impaired peritoneal macrophage NLRC4 inflammasome responses, marked by decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with flagellin (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced IL-1β secretion after flagellin treatment using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 101 mutations (X-axis) identified in the G1 male of pedigree R2256. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 101 mutations. The diminished NLRC4 inflammasome function phenotype was linked by continuous variable mapping to a mutation in Nlrc4:  a T to C transversion at base pair 74,445,630 (v38) on chromosome 17, or base pair 13,514 in the GenBank genomic region NC_000083.  Linkage was found with a recessive model of inheritance (P = 0.0314), wherein two variant homozygotes departed phenotypically from two homozygous reference mice and three heterozygous mice (Figure 2).  

The mutation corresponds to residue 1,973 in the mRNA sequence NM_001033367 within exon 4 of 9 total exons.

1957 GGTAAAAGTTTATACATCAACTCAGAGAACATC 580  -G--K--S--L--Y--I--N--S--E--N--I-

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to threonine (T) substitution at position 586 (I586T) in the NLRC4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999) (1).

Protein Prediction

Figure 3. Domain structure of NLRC4. Shown are the caspase-recruitment domain (CARD), NACHT domain, nucleotide binding domain (NBD), winged helix domain (WHD), helical domains 1 and 2 (HD1 and HD2, respectively), and leucine-rich repeat (LRR) domains. The amino acid altered by the inwood mutation is shown.

The Nlrc4 gene encodes the 1,024 amino acid protein, NLRC4 [NLR family caspase activating and recruitment domain (CARD)-containing protein 4; alternatively, IPAF (ICE-protease-activating factor), Card12 (caspase-associated recruitment domain 12), and CLAN (for CARD, LRR, and NACHT-containing protein)]. NLRC4 is a member of the nucleotide-binding domain (NBD) and leucine-rich repeat (LRR) (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family (2-5). NLR proteins can be classified as either NLRBs (NLR containing the baculovirus inhibitory (BIR) domain), NLRCs (NLRs containing the caspase-recruitment domain (CARD) domain), or NLRPs (NLRs containing the PYD domain; see the record Nd1 for information about Nlrp3) (6).

NLRC4 has several domains including an N-terminal CARD domain (amino acids 1-88), a central oligomerization NACHT domain (amino acids 163-476) with a C-terminal extension known as the NACHT-associated domain (NAD), and a C-terminal leucine-rich repeat (LRR) (amino acids 578-1021) (Figure 3). 

The CARD domain of NLRC4 mediates the specificity of NLRC4 protein-protein interactions with other CARD-containing proteins (e.g., the inflammasome adaptor protein ASC (apoptosis-associated speck-like protein containing CARD) and caspase-1) to facilitate assembly into complexes. CARD domains have six or seven antiparallel alpha-helices and are similar in structure to death domains and death effector domains found in death receptors [e.g., Fas (see the record for cherry) and Cd40 (see the record for bluebonnet)], which facilitate the activation of caspase-8 and caspase-10 (7).

The NACHT acronym is derived from the four plant and animal proteins that initially defined the unique features of this domain: the neuronal apoptosis inhibitory protein (NAIP), MHC class II transcription activator (CIITA), incompatibility locus protein from Podospora anserina (HET-E), and telomerase-associated protein (TP1). The NACHT domain is a predicted nucleotide triphosphatase (NTPase) domain. The NACHT domain of NLRC4 is subdivided into a nucleotide-binding domain (NBD; amino acids 95-298), a helical domain 1 (HD1; amino acids 299-355), a winged helix domain (WHD; amino acids 356-463), and a helical domain 2 (HD2; amino acids 464-475). The NBD mediates protein oligomerization as well as the interaction of NLRC4 with NAIPs. NLRC4 is an adapter for the NAIP sensors during the formation of the NAIP/NLRC4/caspase-1 inflammasome (8). The NAIPs act as receptors for bacterial ligands: NAIP5 recognizes flagellin (9), NAIP1 recognizes needle rod proteins, and NAIP2 recognizes inner rod proteins. Needle and inner rod proteins are structural components of the type III secretory system (T3SS). There is no evidence that NLRC4 binds or senses microbial ligands independent of NAIPs.

In NLR proteins, the NACHT and the NBD consist of twelve distinct conserved motifs, including the ATP/GTPase specific P-loop (Walker A motif) and the magnesium (Mg²⁺)-binding site (Walker B motif) (10;11). The Walker A motif contains the sequence GKS/T corresponding to amino acids 174-176 in mouse NLRC4; the lysine coordinates the γ-phosphate of NTPs (12;13). The unique features of the NACHT domain include the prevalence of small residues (glycine, alanine or serine) directly C-terminal of the Mg²⁺-coordinating aspartate in the Walker B motif, in place of a second acidic residue prevalent in other NTPases. A second acidic residue is typically found in the NACHT-containing proteins two positions downstream. Distal to the Walker A and B motifs, these domains also have a conserved pattern of polar, aromatic and hydrophobic residues that is not seen in any other NTPase family (11). A crystal structure of mouse NLRC4 lacking the CARD domain and several internal residues (amino acids 1-89 and 622-644, respectively) was solved [mNLRC4ΔCARD; PDB:4KXF; (14)]. The mNLRC4ΔCARD protein was shaped similar to an inverted question mark (14). The NBD of mNLRC4ΔCARD is a three-layered α/β structure with an additional β hairpin (β3 and β4). The HD2 domain forms a cap at the N-terminal side of the LRR domain. An ADP-binding site is formed by amino acids 169-176. ADP binding is essential for maintaining mNLRC4ΔCARD in an inactive conformation. The β sheet (β1 and β2) pushes the WHD away from the NBD and the WHD faces the front of the ADP binding site, facilitating the formation of a closed conformation. After oligomerization, the WHD undergoes remodeling relative to the NBD. The HD2 domain is proposed to function in NLRC4 autoinhibition (14). The HD2 domain associates with α8 from the NBD; residues in α8 (e.g., Arg288 and Arg285) are essential for flagellin-induced IL-1β activation.

LRR-containing domains generally consist of 2-45 motifs of 20-30 amino acids in length (15). LRRs occur in proteins ranging from viruses to eukaryotes, and appear to provide a structural framework for the formation of protein-protein interactions. Sequence analyses of LRR proteins suggests the existence of several different subfamilies of LRRs (16), but all major classes of LRRs have curved horseshoe structures with a parallel β-sheet on the concave side and mostly helical elements on the convex side. Eleven-residue segments of the LRRs (LxxLxLxxN/CxL), corresponding to the β-strand and adjacent loop regions, are conserved in LRR proteins, whereas the remaining parts of the repeats may be very different. Despite the differences, each of the variable parts contain two half-turns at both ends and a "linear" segment, usually formed by a helix, in the middle. The concave face and the adjacent loops are the most common protein interaction surfaces on LRR proteins. 3D structures of some LRR proteins-ligand complexes show that the concave surface of LRR domain is ideal for interaction with α-helical structures. Molecular modeling suggests that the conserved pattern LxxLxL, which is shorter than the previously proposed LxxLxLxxN/CxL, is sufficient to impart the characteristic horseshoe curvature to proteins with 20- to 30-residue repeats (15;16). The LRR domain of NLRC4 is proposed to function as an autoinhibitory domain as the LRR domain curves back to block the NBD (14). The LRR domain of NLRC4 also is proposed to act as a sensor to directly or indirectly detect ligands (17). Binding of ligands to the LRR domain is proposed to disrupt the autoinhibitory interactions between the LRR and the NBD, subsequently allowing for oligomerization of NLRC4 and the assembly of the NLRC4 inflammasome (14;17;18).

PKCδ-mediated phosphorylation of NLRC4 on Ser533 is required for NLRC4 inflammasome assembly (19;20). Mutation of Ser533 to alanine (Ser533Ala) resulted in loss of both procaspase-1 recruitment and inflammasome assembly following infection with S. typhimurium (20). β-arrestin1 interacts with NLRC4 to promote its self-oligomerization, and subsequent optimum IL-1β production upon activation of the NLRC4 inflammasome  (21).  

The inwood mutation results in an isoleucine to threonine amino acid change at residue 586 within the first LRR.

Expression/Localization

NLRC4 is ubiquitously expressed. NLRC4 is highly expressed in kidneys, muscle, lung, bladder, cervix, heart, endothelial cells, macrophages, neutrophils, monocytes, peripheral blood mononuclear cells, and intestinal epithelial cells.  NLRC4 localizes to the cytoplasm.

Background

Figure 4. Activation of the NLRC4 inflammasome. Infection of macrophages with various gram-negative bacteria activates caspase-1 via NLRC4. A critical step is the cytosolic delivery of flagellin or proteins through the bacterial T3SS or T4SS. Flagellin is recognized by Naip5 or Naip6,  whereas rod proteins are recognized by Naip2. S. flexneri activates the NLRC4 inflammasome independently of flagellin through IpaB. Activation of caspase-1 via NLRC4 leads to the processing and release of IL-1β and IL-18, the processing of caspase-7, and pyroptosis. This image is interactive; click to view other mutations associated with the NLRC4 inflammasome pathway.

Members of the NLR family, including NLRC4, NLRP1b, and NLRP3, are able to oligomerize through their NBD domains and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. Inflammasome assembly has now been shown to be activated in response to diverse agents that include pathogens, DNA, single-stranded (ss) RNA, double-stranded (ds) RNA, bacterial toxins, and environmental irritants as well as endogenous danger signals [reviewed by (22;23)]. The NLRC4 inflammasome stimulates caspase-1 activation and subsequent IL-1β secretion from macrophages after exposure to lipopolysaccharide, peptidoglycan, and pathogenic bacteria (Figure 4) (24). Caspase-1 is a cysteine protease that is present under resting conditions in an inactive precursor form with an N-terminal CARD-containing prodomain capable of mediating homotypic interactions. The CARD domain of procaspase-1 recruits the protease to the inflammasome where it undergoes autoproteolytic maturation into its active form. NLRC4 interacts with ASC, but the NLRC4 inflammasome does not require ASC to recruit and activate caspase-1. NLRC4 can directly interact with pro-caspase-1 through interactions between their respective CARD domains; therefore, the role of ASC in NLRC4-mediated caspase-1 activation is unknown. ASC-deficient macrophages exhibited reduced caspase-1 activation and IL-1β secretion in response to Salmonella, Shigella, and Pseudomonas; however, the macrophages underwent cell death in response to infection (25-27). Taken together, ASC may be required for NLRC4-mediated caspase-1 activation, but is not required for NLRC4-mediated cell death. Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes in by activating key processes such as the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK; see the record for wabasha) pathways. In contrast to NLRP3-associated caspase-1 activation, which predominantly results in the processing and secretion of IL-1β and IL-18 without necessarily resulting in cell death, NLRC4-mediated activation of caspase-1 often results in cell death [reviewed in (28)].

NLRC4 inflammasomes are primarily activated by gram-negative bacteria including Aeromonas veronii (29), Escherichia coli (30), Listeria monocytogenes (31), Pseudomonas aeruginosa (30), Salmonella enterica serovar typhimurium (S. typhimurium) (30;32-34), and Yersinia species (35). The T3SS (e.g., S. typhimurium) and type IV secretion system (T4SS; e.g., L. pneumophila) are virulence factors associated with most gram-negative pathogens that activate the NLRC4 inflammasome (30;36). The T3SS/T4SS facilitates the passage of secreted proteins (e.g., cytosolic flagellin and rod protein) into the cytoplasm of the host cell through a needle-like complex that spans the bacterial membranes and periplasm. The secreted proteins block host defenses, subsequently promoting the intracellular replication of the bacteria. In the case of flagellin, it can be delivered to the cytosol through the T3SS or the T4SS (30). After delivery of flagellin to the cytosol, the NAIP5/NLRC4 inflammasome is formed and caspase-1 is activated (37;38). NLRC4-associated immune responses can also be induced in response to extracellular flagellin that is recognized by toll-like receptor 5 (TLR5) (39). Once TLR5 recognizes flagellin, it recruits the adaptor protein MyD88 (see the record for pococurante) through hemophilic TIR domain interactions. In the MyD88-dependent pathway, MyD88 recruits IRAK kinases (see the record for otiose) through their death domains. TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2 (see the record for Cosmo). Activation of TAK1 leads to activation of MAPK cascades and the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, p105, and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation, releasing NF-κB into the nucleus and permitting TPL2 to become activated, respectively. Activation of the p38, JNK and ERK1/2 kinases leads to the activation of both CREB and AP1, which in turn induce many target genes. IRAK-1 and IKKα phosphorylate and activate IRF7 (see the record for inept), leading to transcription of interferon-inducible genes and production of large amounts of type I IFN. NLRC4-mediated immune responses to flagellin negatively regulate TLR5-mediated responses (40). Li et al. propose that the NLRC4-mediated negative regulation in response to flagellin is due to reduced amounts of macrophages and subsequent cytokine secretion.

More details about known activators of the NLRC4 inflammasome are described in more detail, below.

Shigella flexneri

NLRC4 functions in the cellular response to Shigella flexneri infection, which induces caspase-1 activation, IL-1β processing and cell death in macrophages though the bacterial T3SS (25;41). Caspase-1 activation in response to Shigella is independent of flagellin, but requires IpaB, a bacterial protein secreted by the T3SS. Caspase-1 can also be activated by lipopolysaccharide released from the bacteria (25).

Salmonella typhimurium

In response to Salmonella typhimurium infection, caspase-1-induced cleavage of pro-IL-1β and IL-18 occurs with a concomitant induction of cell death and caspase-7 activation (24;32-34;42;43). NLRC4-mediated caspase-1 activation upon Salmonella infection requires Salmonella Pathogenicity Island 1 (SPI1), a factor of the T3SS. In Salmonella infection, flagellin is delivered into the cell through the T3SS during the transfer of other virulence factors, resulting in NLRC4 inflammasome recruitment and activation of caspase-1 (44;45). NLRC4 inflammasome activation by S. typhimurium in CD8α⁺ dendritic cells leads to the release of IL-18, and subsequently to the secretion of IFN-γ by CD8⁺ T cells (46).

Legionella pneumophila

Legionella pneumophila replicates in monocytes and macrophages and leads to a severe form of pneumonia called Legionnaires’ disease. L. pneumophila infection requires flagellin (47;48). Inside of host macrophages, L. pneumophila induces the expression of genes that encode factors in the Dot/Icm T4SS (44;49). The NLRC4 inflammasome promotes both caspase-1-dependent and –independent responses to restrict the growth of L. pneumonphila (47;50). Upon L. pneumophila infection, caspase-7 is activated downstream of the NLRC4 inflammasome and requires flagellin, NAIP5, and caspase-1 induction (49).

Pseudomonas aerugenosa

Pseudomonas aerugenosa infection causes a strong induction of inflammatory cytokines such as IL-1β and IL-18 in host tissues as well as subsequent pyroptotic cell death (27;51); the T3SS is required for NLRC4-induced caspase-1 activation in response to P. aeruginosa (51).

Klebsiella pneumonia and Burkholderia pseudomallei

NLRC4 also promotes survival and limits bacterial translocation to multiple organs upon infection of mouse models during infection of Klebsiella pneumonia (52) and Burkholderia pseudomallei (53). NLRC4 is essential for host survival and bacterial clearance as well as neutrophil-mediated inflammation in the lungs after K. pneumonia infection (52). NLRC4 is necessary for the production of IL-1β, IL-17A, and neutrophil chemoattractants (e.g., keratinocyte cell-derived chemokines, MIP-2, and LPS-induced CXC chemokines) in the lungs.

Citrobacter rodentium

In intestinal epithelial cells, NLRC4 protects against infection by Citrobacter rodentium, a bacterial pathogen that causes colonic crypt hyperplasia and diarrhea (54). Loss of Nlrc4 expression resulted in increased bacterial adherence to the gut tissue, increased intestinal inflammation, and weight loss; however, loss of Nlrc4 expression did not cause an inability to eventually clear the infection, indicating that NLRC4 activation is essential at an early stage following C. rodentium infection.

Candida albicans

NLRC4 expression is induced in the oral mucosa upon infection with the fungal pathogen, Candida albicans (55).  In response to C. albicans, the NLRC4 inflammasome functions in the mucosal lining of the mouth and intestines, instead of in immune cells.

Additional functions of the NAIP/NLRC4 inflammasome

The NAIP/NLRC4 inflammasome also has an epithelial-intrinsic function. The epithelial-intrinsic role is not involved in regulating inflammasome-dependent cytokines, but regulates the inflammasome-dependent expulsion of infected epithelial cells into the intestinal lumen (56).

Human Conditions linked to NLRC4

Gain-of-function mutations in NLRC4 have been linked to an anti-inflammatory condition termed SCAN4 (syndrome of enterocolitis and auto-inflammation associated with mutation in NLRC4) (57). SCAN4 is characterized by fever, diarrhea, splenomegaly, duodenal inflammation, anemia, and hypertriglyceridemia as well as elevated amounts of inflammatory markers including ferritin, C-reactive protein, and IL-18. In addition to SCAN4, NLRC4 gain-of-function mutations are linked to NLRC4-MAS (NLRC4 macrophage activation syndrome) (58). NLRC4-MAS is marked by spontaneous inflammasome formation and subsequent increased production of IL-1β and IL-18 (58). Patients with NLRC4-MAS exhibit recurring episodes of fever, malaise, pancytopenia, splenomegaly, vomiting, loose stools with mild duodenitis, impaired NK cell killing, and occasional rash beginning at six months of age. If untreated, NLRC4-MAS can lead to coagulopathy, organ failure, and death. NLRC4-MAS is a complication of some inflammatory diseases including systemic lupus erythematosus and systemic juvenile idiopathic arthritis. In addition, NLRC4-MAS can be triggered by infections and malignancies. Activating mutations in NLRC4 can cause familial cold autoinflammatory syndrome (FCAS) (59). FCAS is a cryopyrin-associated periodic syndrome (CAPS) and is characterized by rash, fever, and arthralgia following exposure to cold stimuli.

NLRC4 is upregulated during the acute phase of Kawasaki disease, a disease characterized by high levels of serum proinflammatory cytokines and chemokines at the acute phase (60). Kawasaki disease often leads to vasculitis, myocardial infarction, and sudden death.

The NLRC4 inflammasome is linked to colonic inflammation-induced tumor formation (61). Inflammation-induced colorectal cancer occurs in some patients with chronic inflammatory bowel disease. Tumor formation is proposed to be due to chronic epithelial cell exposure to reactive species, IL-6, and TNF-α [reviewed in (61)].

Putative Mechanism

The reduced amount of IL-1β secreted from inwood macrophages in response to flagellin indicates that NLRC4^inwood exhibits loss of function. The response to factors associated with the T3SS or the T4SS have not been tested. The inwood mutation is within the first LRR, which are domains that are required for protein-protein interactions as well as the sensing of ligands and NLRC4 inflammasome assembly.

Primers

PCR Primer
Inwood_pcr_F: ATGTAGGTTTCTGAGGGCCC
Inwood_pcr_R: ATGGTTTATCAGCACGGCAGC

Sequencing Primer
Inwood_seq_F: CTTCTGTGTGAACTCCAGGGAC
Inwood_seq_R: GGCAGCCTACAAGGACTTTCAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 17, - strand):

1   atggtttatc agcacggcag cctacaagga ctttcagtca ccaagaggcc tctctggagg
61  caggaatcaa tccagagtct gagaaatacc actgagcaag atgttctgaa agccatcaat
121 gtaaattcct tcgtagagtg tggcatcaat ttgttctcag agagtatgtc taaatcagac
181 ctgagccaag aatttgaagc tttctttcaa ggtaaaagtt tatacatcaa ctcagagaac
241 atccctgact atttatttga cttctttgaa tacttgccta attgtgcaag cgcattggac
301 ttcgtgaagt tggatttcta tgaaagagct acagagtcac aggacaaggc agaagagaat
361 gtccctggag ttcacacaga agggccctca gaaacctaca t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Damiano, J. S., Stehlik, C., Pio, F., Godzik, A., and Reed, J. C. (2001) CLAN, a Novel Human CED-4-Like Gene. Genomics. 75, 77-83.

  3. Geddes, B. J., Wang, L., Huang, W. J., Lavellee, M., Manji, G. A., Brown, M., Jurman, M., Cao, J., Morgenstern, J., Merriam, S., Glucksmann, M. A., DiStefano, P. S., and Bertin, J. (2001) Human CARD12 is a Novel CED4/Apaf-1 Family Member that Induces Apoptosis. Biochem Biophys Res Commun. 284, 77-82.

  4. Poyet, J. L., Srinivasula, S. M., Tnani, M., Razmara, M., Fernandes-Alnemri, T., and Alnemri, E. S. (2001) Identification of Ipaf, a Human Caspase-1-Activating Protein Related to Apaf-1. J Biol Chem. 276, 28309-28313.

  5. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.

  6. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.

  7. Aravind, L., Dixit, V. M., and Koonin, E. V. (1999) The Domains of Death: Evolution of the Apoptosis Machinery. Trends Biochem Sci. 24, 47-53.

  8. Tenthorey, J. L., Kofoed, E. M., Daugherty, M. D., Malik, H. S., and Vance, R. E. (2014) Molecular Basis for Specific Recognition of Bacterial Ligands by NAIP/NLRC4 Inflammasomes. Mol Cell. 54, 17-29.

  9. Halff, E. F., Diebolder, C. A., Versteeg, M., Schouten, A., Brondijk, T. H., and Huizinga, E. G. (2012) Formation and Structure of a NAIP5-NLRC4 Inflammasome Induced by Direct Interactions with Conserved N- and C-Terminal Regions of Flagellin. J Biol Chem. 287, 38460-38472.

  10. Harton, J. A., Linhoff, M. W., Zhang, J., and Ting, J. P. (2002) Cutting Edge: CATERPILLER: A Large Family of Mammalian Genes Containing CARD, Pyrin, Nucleotide-Binding, and Leucine-Rich Repeat Domains. J Immunol. 169, 4088-4093.

  11. Koonin, E. V., and Aravind, L. (2000) The NACHT Family - a New Group of Predicted NTPases Implicated in Apoptosis and MHC Transcription Activation. Trends Biochem Sci. 25, 223-224.

  12. Anderson, J. P., Mueller, J. L., Rosengren, S., Boyle, D. L., Schaner, P., Cannon, S. B., Goodyear, C. S., and Hoffman, H. M. (2004) Structural, Expression, and Evolutionary Analysis of Mouse CIAS1. Gene. 338, 25-34.

  13. Duncan, J. A., Bergstralh, D. T., Wang, Y., Willingham, S. B., Ye, Z., Zimmermann, A. G., and Ting, J. P. (2007) Cryopyrin/NALP3 Binds ATP/dATP, is an ATPase, and Requires ATP Binding to Mediate Inflammatory Signaling. Proc Natl Acad Sci U S A. 104, 8041-8046.

  14. Hu, Z., Yan, C., Liu, P., Huang, Z., Ma, R., Zhang, C., Wang, R., Zhang, Y., Martinon, F., Miao, D., Deng, H., Wang, J., Chang, J., and Chai, J. (2013) Crystal Structure of NLRC4 Reveals its Autoinhibition Mechanism. Science. 341, 172-175.

  15. Enkhbayar, P., Kamiya, M., Osaki, M., Matsumoto, T., and Matsushima, N. (2004) Structural Principles of Leucine-Rich Repeat (LRR) Proteins. Proteins. 54, 394-403.

  16. Kajava, A. V., and Kobe, B. (2002) Assessment of the Ability to Model Proteins with Leucine-Rich Repeats in Light of the Latest Structural Information. Protein Sci. 11, 1082-1090.

  17. Danot, O., Marquenet, E., Vidal-Ingigliardi, D., and Richet, E. (2009) Wheel of Life, Wheel of Death: A Mechanistic Insight into Signaling by STAND Proteins. Structure. 17, 172-182.

  18. Faustin, B., Lartigue, L., Bruey, J. M., Luciano, F., Sergienko, E., Bailly-Maitre, B., Volkmann, N., Hanein, D., Rouiller, I., and Reed, J. C. (2007) Reconstituted NALP1 Inflammasome Reveals Two-Step Mechanism of Caspase-1 Activation. Mol Cell. 25, 713-724.

  19. Matusiak, M., Van Opdenbosch, N., Vande Walle, L., Sirard, J. C., Kanneganti, T. D., and Lamkanfi, M. (2015) Flagellin-Induced NLRC4 Phosphorylation Primes the Inflammasome for Activation by NAIP5. Proc Natl Acad Sci U S A. 112, 1541-1546.

  20. Qu, Y., Misaghi, S., Izrael-Tomasevic, A., Newton, K., Gilmour, L. L., Lamkanfi, M., Louie, S., Kayagaki, N., Liu, J., Komuves, L., Cupp, J. E., Arnott, D., Monack, D., and Dixit, V. M. (2012) Phosphorylation of NLRC4 is Critical for Inflammasome Activation. Nature. 490, 539-542.

  21. Mao, K., Chen, S., Wang, Y., Zeng, Y., Ma, Y., Hu, Y., Zhang, H., Sun, S., Wu, X., Meng, G., Pei, G., and Sun, B. (2015) Beta-arrestin1 is Critical for the Full Activation of NLRP3 and NLRC4 Inflammasomes. J Immunol. 194, 1867-1873.

  22. Schroder, K., Zhou, R., and Tschopp, J. (2010) The NLRP3 Inflammasome: A Sensor for Metabolic Danger? Science. 327, 296-300.

  23. Tschopp, J., and Schroder, K. (2010) NLRP3 Inflammasome Activation: The Convergence of Multiple Signalling Pathways on ROS Production? Nat Rev Immunol. 10, 210-215.

  24. Damiano, J. S., Newman, R. M., and Reed, J. C. (2004) Multiple Roles of CLAN (Caspase-Associated Recruitment Domain, Leucine-Rich Repeat, and NAIP CIIA HET-E, and TP1-Containing Protein) in the Mammalian Innate Immune Response. J Immunol. 173, 6338-6345.

  25. Suzuki, T., Franchi, L., Toma, C., Ashida, H., Ogawa, M., Yoshikawa, Y., Mimuro, H., Inohara, N., Sasakawa, C., and Nunez, G. (2007) Differential Regulation of Caspase-1 Activation, Pyroptosis, and Autophagy Via Ipaf and ASC in Shigella-Infected Macrophages. PLoS Pathog. 3, e111.

  26. Mariathasan, S., Newton, K., Monack, D. M., Vucic, D., French, D. M., Lee, W. P., Roose-Girma, M., Erickson, S., and Dixit, V. M. (2004) Differential Activation of the Inflammasome by Caspase-1 Adaptors ASC and Ipaf. Nature. 430, 213-218.

  27. Sutterwala, F. S., Mijares, L. A., Li, L., Ogura, Y., Kazmierczak, B. I., and Flavell, R. A. (2007) Immune Recognition of Pseudomonas Aeruginosa Mediated by the IPAF/NLRC4 Inflammasome. J Exp Med. 204, 3235-3245.

  28. Sutterwala, F. S., and Flavell, R. A. (2009) NLRC4/IPAF: A CARD Carrying Member of the NLR Family. Clin Immunol. 130, 2-6.

  29. McCoy, A. J., Koizumi, Y., Higa, N., and Suzuki, T. (2010) Differential Regulation of Caspase-1 Activation Via NLRP3/NLRC4 Inflammasomes Mediated by Aerolysin and Type III Secretion System during Aeromonas Veronii Infection. J Immunol. 185, 7077-7084.

  30. Miao, E. A., Mao, D. P., Yudkovsky, N., Bonneau, R., Lorang, C. G., Warren, S. E., Leaf, I. A., and Aderem, A. (2010) Innate Immune Detection of the Type III Secretion Apparatus through the NLRC4 Inflammasome. Proc Natl Acad Sci U S A. 107, 3076-3080.

  31. Wu, J., Fernandes-Alnemri, T., and Alnemri, E. S. (2010) Involvement of the AIM2, NLRC4, and NLRP3 Inflammasomes in Caspase-1 Activation by Listeria Monocytogenes. J Clin Immunol. 30, 693-702.

  32. Miao, E. A., Alpuche-Aranda, C. M., Dors, M., Clark, A. E., Bader, M. W., Miller, S. I., and Aderem, A. (2006) Cytoplasmic Flagellin Activates Caspase-1 and Secretion of Interleukin 1beta Via Ipaf. Nat Immunol. 7, 569-575.

  33. Franchi, L., Amer, A., Body-Malapel, M., Kanneganti, T. D., Ozoren, N., Jagirdar, R., Inohara, N., Vandenabeele, P., Bertin, J., Coyle, A., Grant, E. P., and Nunez, G. (2006) Cytosolic Flagellin Requires Ipaf for Activation of Caspase-1 and Interleukin 1beta in Salmonella-Infected Macrophages. Nat Immunol. 7, 576-582.

  34. Broz, P., Newton, K., Lamkanfi, M., Mariathasan, S., Dixit, V. M., and Monack, D. M. (2010) Redundant Roles for Inflammasome Receptors NLRP3 and NLRC4 in Host Defense Against Salmonella. J Exp Med. 207, 1745-1755.

  35. Brodsky, I. E., Palm, N. W., Sadanand, S., Ryndak, M. B., Sutterwala, F. S., Flavell, R. A., Bliska, J. B., and Medzhitov, R. (2010) A Yersinia Effector Protein Promotes Virulence by Preventing Inflammasome Recognition of the Type III Secretion System. Cell Host Microbe. 7, 376-387.

  36. Hueck, C. J. (1998) Type III Protein Secretion Systems in Bacterial Pathogens of Animals and Plants. Microbiol Mol Biol Rev. 62, 379-433.

  37. Zhao, Y., Yang, J., Shi, J., Gong, Y. N., Lu, Q., Xu, H., Liu, L., and Shao, F. (2011) The NLRC4 Inflammasome Receptors for Bacterial Flagellin and Type III Secretion Apparatus. Nature. 477, 596-600.

  38. Lightfield, K. L., Persson, J., Trinidad, N. J., Brubaker, S. W., Kofoed, E. M., Sauer, J. D., Dunipace, E. A., Warren, S. E., Miao, E. A., and Vance, R. E. (2011) Differential Requirements for NAIP5 in Activation of the NLRC4 Inflammasome. Infect Immun. 79, 1606-1614.

  39. Hayashi, F., Smith, K. D., Ozinsky, A., Hawn, T. R., Yi, E. C., Goodlett, D. R., Eng, J. K., Akira, S., Underhill, D. M., and Aderem, A. (2001) The Innate Immune Response to Bacterial Flagellin is Mediated by Toll- Like Receptor 5. Nature. 410, 1099-1103.

  40. Li, W., Yang, J., Zhang, E., Zhong, M., Xiao, Y., Yu, J., Zhou, D., Cao, Y., Yang, Y., Li, Y., and Yan, H. (2015) Activation of NLRC4 Downregulates TLR5-Mediated Antibody Immune Responses Against Flagellin. Cell Mol Immunol. .

  41. Schroeder, G. N., Jann, N. J., and Hilbi, H. (2007) Intracellular Type III Secretion by Cytoplasmic Shigella Flexneri Promotes Caspase-1-Dependent Macrophage Cell Death. Microbiology. 153, 2862-2876.

  42. Lamkanfi, M., Kanneganti, T. D., Van Damme, P., Vanden Berghe, T., Vanoverberghe, I., Vandekerckhove, J., Vandenabeele, P., Gevaert, K., and Nunez, G. (2008) Targeted Peptidecentric Proteomics Reveals Caspase-7 as a Substrate of the Caspase-1 Inflammasomes. Mol Cell Proteomics. 7, 2350-2363.

  43. Lara-Tejero, M., Sutterwala, F. S., Ogura, Y., Grant, E. P., Bertin, J., Coyle, A. J., Flavell, R. A., and Galan, J. E. (2006) Role of the Caspase-1 Inflammasome in Salmonella Typhimurium Pathogenesis. J Exp Med. 203, 1407-1412.

  44. Amer, A., Franchi, L., Kanneganti, T. D., Body-Malapel, M., Ozoren, N., Brady, G., Meshinchi, S., Jagirdar, R., Gewirtz, A., Akira, S., and Nunez, G. (2006) Regulation of Legionella Phagosome Maturation and Infection through Flagellin and Host Ipaf. J Biol Chem. 281, 35217-35223.

  45. Sun, Y. H., Rolan, H. G., and Tsolis, R. M. (2007) Injection of Flagellin into the Host Cell Cytosol by Salmonella Enterica Serotype Typhimurium. J Biol Chem. 282, 33897-33901.

  46. Kupz, A., Guarda, G., Gebhardt, T., Sander, L. E., Short, K. R., Diavatopoulos, D. A., Wijburg, O. L., Cao, H., Waithman, J. C., Chen, W., Fernandez-Ruiz, D., Whitney, P. G., Heath, W. R., Curtiss, R.,3rd, Tschopp, J., Strugnell, R. A., and Bedoui, S. (2012) NLRC4 Inflammasomes in Dendritic Cells Regulate Noncognate Effector Function by Memory CD8(+) T Cells. Nat Immunol. 13, 162-169.

  47. Pereira, M. S., Morgantetti, G. F., Massis, L. M., Horta, C. V., Hori, J. I., and Zamboni, D. S. (2011) Activation of NLRC4 by Flagellated Bacteria Triggers Caspase-1-Dependent and -Independent Responses to Restrict Legionella Pneumophila Replication in Macrophages and in Vivo. J Immunol. 187, 6447-6455.

  48. Pereira, M. S., Marques, G. G., Dellama, J. E., and Zamboni, D. S. (2011) The Nlrc4 Inflammasome Contributes to Restriction of Pulmonary Infection by Flagellated Legionella Spp. that Trigger Pyroptosis. Front Microbiol. 2, 33.

  49. Akhter, A., Gavrilin, M. A., Frantz, L., Washington, S., Ditty, C., Limoli, D., Day, C., Sarkar, A., Newland, C., Butchar, J., Marsh, C. B., Wewers, M. D., Tridandapani, S., Kanneganti, T. D., and Amer, A. O. (2009) Caspase-7 Activation by the Nlrc4/Ipaf Inflammasome Restricts Legionella Pneumophila Infection. PLoS Pathog. 5, e1000361.

  50. Case, C. L., Shin, S., and Roy, C. R. (2009) Asc and Ipaf Inflammasomes Direct Distinct Pathways for Caspase-1 Activation in Response to Legionella Pneumophila. Infect Immun. 77, 1981-1991.

  51. Miao, E. A., Ernst, R. K., Dors, M., Mao, D. P., and Aderem, A. (2008) Pseudomonas Aeruginosa Activates Caspase 1 through Ipaf. Proc Natl Acad Sci U S A. 105, 2562-2567.

  52. Cai, S., Batra, S., Wakamatsu, N., Pacher, P., and Jeyaseelan, S. (2012) NLRC4 Inflammasome-Mediated Production of IL-1beta Modulates Mucosal Immunity in the Lung Against Gram-Negative Bacterial Infection. J Immunol. 188, 5623-5635.

  53. Ceballos-Olvera, I., Sahoo, M., Miller, M. A., Del Barrio, L., and Re, F. (2011) Inflammasome-Dependent Pyroptosis and IL-18 Protect Against Burkholderia Pseudomallei Lung Infection while IL-1beta is Deleterious. PLoS Pathog. 7, e1002452.

  54. Nordlander, S., Pott, J., and Maloy, K. J. (2014) NLRC4 Expression in Intestinal Epithelial Cells Mediates Protection Against an Enteric Pathogen. Mucosal Immunol. 7, 775-785.

  55. Tomalka, J., Ganesan, S., Azodi, E., Patel, K., Majmudar, P., Hall, B. A., Fitzgerald, K. A., and Hise, A. G. (2011) A Novel Role for the NLRC4 Inflammasome in Mucosal Defenses Against the Fungal Pathogen Candida Albicans. PLoS Pathog. 7, e1002379.

  56. Sellin, M. E., Muller, A. A., Felmy, B., Dolowschiak, T., Diard, M., Tardivel, A., Maslowski, K. M., and Hardt, W. D. (2014) Epithelium-Intrinsic NAIP/NLRC4 Inflammasome Drives Infected Enterocyte Expulsion to Restrict Salmonella Replication in the Intestinal Mucosa. Cell Host Microbe. 16, 237-248.

  57. Romberg, N., Al Moussawi, K., Nelson-Williams, C., Stiegler, A. L., Loring, E., Choi, M., Overton, J., Meffre, E., Khokha, M. K., Huttner, A. J., West, B., Podoltsev, N. A., Boggon, T. J., Kazmierczak, B. I., and Lifton, R. P. (2014) Mutation of NLRC4 Causes a Syndrome of Enterocolitis and Autoinflammation. Nat Genet. 46, 1135-1139.

  58. Canna, S. W., de Jesus, A. A., Gouni, S., Brooks, S. R., Marrero, B., Liu, Y., DiMattia, M. A., Zaal, K. J., Sanchez, G. A., Kim, H., Chapelle, D., Plass, N., Huang, Y., Villarino, A. V., Biancotto, A., Fleisher, T. A., Duncan, J. A., O'Shea, J. J., Benseler, S., Grom, A., Deng, Z., Laxer, R. M., and Goldbach-Mansky, R. (2014) An Activating NLRC4 Inflammasome Mutation Causes Autoinflammation with Recurrent Macrophage Activation Syndrome. Nat Genet. 46, 1140-1146.

  59. Kitamura, A., Sasaki, Y., Abe, T., Kano, H., and Yasutomo, K. (2014) An Inherited Mutation in NLRC4 Causes Autoinflammation in Human and Mice. J Exp Med. 211, 2385-2396.

  60. Ikeda, K., Yamaguchi, K., Tanaka, T., Mizuno, Y., Hijikata, A., Ohara, O., Takada, H., Kusuhara, K., and Hara, T. (2010) Unique Activation Status of Peripheral Blood Mononuclear Cells at Acute Phase of Kawasaki Disease. Clin Exp Immunol. 160, 246-255.

  61. Hu, B., Elinav, E., Huber, S., Booth, C. J., Strowig, T., Jin, C., Eisenbarth, S. C., and Flavell, R. A. (2010) Inflammation-Induced Tumorigenesis in the Colon is Regulated by Caspase-1 and NLRC4. Proc Natl Acad Sci U S A. 107, 21635-21640.