Phenotypic Mutation 'rose2'

• Allele: rose2
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 34,413,915 bp (GRCm39)
• Base Change: T ⇒ G (forward strand)
• Gene: Tap1
• Gene Name: transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
• Synonym(s): TAP, Ham1, RING4, MTP1, Tap-1, Ham-1, Abcb2, PSF-1
• Chromosomal Location: 34,406,530-34,416,199 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009] ; PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glutamic Acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000039264] [ENSMUSP00000128401]
• AlphaFold: P21958
• SMART Domains: Protein: ENSMUSP00000039264; Gene: ENSMUSG00000037321; AA Change: D615E

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
transmembrane domain	116	138	N/A	INTRINSIC
Pfam:ABC_membrane	163	420	9.1e-55	PFAM
AAA	478	666	2.21e-18	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000041633)
• SMART Domains: Protein: ENSMUSP00000128401; Gene: ENSMUSG00000037321; AA Change: D643E

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
transmembrane domain	116	138	N/A	INTRINSIC
Pfam:ABC_membrane	163	434	5.8e-70	PFAM
AAA	506	694	2.21e-18	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000170086)
• SMART Domains: Protein: ENSMUSP00000130189; Gene: ENSMUSG00000037321

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	1	114	1.5e-24	PFAM
Pfam:ABC_tran	167	196	1e-7	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9625
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:45 PM by Diantha La Vine
• Record Created: 2015-05-27 1:02 PM by Duanwu Zhang
• Record Posted: 2016-04-28
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Duanwu Zhang, Tao Yue, Jianhui Wang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_013683, NM_001161730; MGI: 98483

Alleles Listed at MGI

All mutations/alleles(6) : Chemically induced (ENU)(1) Targeted(5)

Phenotypic Description

Figure 1. Rose2 mice exhibit increased viral titers in the spleen 5 days post-infection with mouse cytomegalovirus. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Rose2 mice exhibit decreased frequencies of peripheral CD8 + T cells after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Rose2 mice exhibit decreased frequencies of peripheral CD44 + T cells after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine CD44 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Rose2 mice exhibit decreased frequencies of peripheral CD44 + CD8 + T cells after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine CD44 + CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Rose2 mice exhibit decreased frequencies of peripheral IgM + B cells after MCMV infection. Flow cytometric analysis of peripheral blood was utilized to determine IgM + B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The rose2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1893, some of which exhibited an increased mouse cytomegalovirus (MCMV) titer in the spleen five days after infection (Figure 1), suggesting increased susceptibility to the virus. Some mice also exhibited a diminished frequency of CD8⁺ T cells (Figure 2), CD44⁺ T cells (Figure 3), CD44⁺ CD8⁺ T cells (Figure 4), and IgM⁺ B cells (Figure 5) after MCMV infection, all in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of the increased MCMV viral titer 5 days post-infection using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 104 mutations (X-axis) identified in the G1 male of pedigree R1893. Log phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 104 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tap1:  a T to G transversion at base pair 34,194,941 (v38) on chromosome 17, or base pair 7,386 in the GenBank genomic region NC_000083. The strongest association was found with a recessive model of linkage to the log value of the MCMV titer, wherein 3 variant homozygotes departed phenotypically from 5 homozygous reference mice and 17 heterozygous mice with a P value of 7.851 x 10^-11 (Figure 6).  

The mutation corresponds to residue 2,253 in the mRNA sequence NM_013683 (variant 1) within exon 10 of 11 total exons or residue 2,169 in the mRNA sequence NM_001161730 (variant 2) within exon 11 of 12 total exons.

7369 CTCCTGCTTATCTTGGATGATGCCACCAGTGCC 638  -L--L--L--I--L--D--D--A--T--S--A- (isoform 1; NP_038711) 610  -L--L--L--I--L--D--D--A--T--S--A- (isoform 2; NP_001155202)

Genomic numbering corresponds to NC_000083. The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid (D) to glutamic acid (E) substitution at position 643 (D643E) in isoform 1 and a D to E substitution at position 615 (D615E) in isoform 2 of the TAP1 protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1).

Protein Prediction

Figure 7. Predicted membrane topology of TAP. Both TAP1 and TAP2 contain a 6-helix core transmembrane domain (TMD; purple) and a cytosolic nucleotide binding domain (NBD). Tapasin binding N-terminal accessory domains (pink) consist of 4 and 3 transmembrane helices for TAP1 and TAP2, respectively. The Walker A (A), Walker B (B), and signature/C-loop motif (C) sequences, involved in ATP binding and/or hydrolysis, and color coded to indicate to which ATPase site they belong (green = consensus site,; orange = degenerate site). The rose2 mutation is indicated. The image is interactive, click to view another Tap1 mutation.

Transporter associated with antigen processing (TAP) is a member of the ATP-binding cassette (ABC) transporter family, ubiquitous proteins that shuttle a variety of substrates, including ions (see record for mayday), sugars, amino acids, peptides, vitamins, lipids, antibiotics, and drugs, across cellular membranes (2;3). All ABC transporters possess a modular architecture, the core of which consists of two hydrophobic transmembrane domains (TMDs) and two cytosolic nucleotide-binding domains (NBDs; also called ABCs) (4). TAP is a heterodimer of the homologous TAP1 and TAP2 (see the record for ganymede) proteins, each of which contains a six-helix TMD and a C-terminal NBD (Figure 7) (5;6). TAP1 and TAP2 also contain N-terminal accessory domains, non-essential for peptide transport, that bind to tapasin, the specialized chaperone that bridges TAP and class I MHC molecules in the peptide loading complex (6;7). The accessory domain of TAP1 consists of four transmembrane helices (5;6).

The rose2 mutation occurs in the Walker B motif (VLILDD) of TAP1, in the consensus aspartic acid residue.

Please see the record rose for information about Tap1.

Putative Mechanism

The TAP complex pumps cytosolic peptides into the endoplasmic reticulum (ER) lumen for loading onto class I major histocompatibility (MHC) molecules and presentation to T lymphocytes. Peptide binding is required to stabilize MHC class I molecules, so mice with disrupted TAP1 or TAP2 genes assemble drastically reduced amounts of MHC class I molecules, and have nearly absent surface expression of MHC class I. Mutations in TAP1 (8;9) cause the rarely occurring bare lymphocyte syndrome type I (type I BLS, OMIM #604571), characterized a reduction in MHC class I surface expression to 1-3% of normal levels. Patients with type I BLS from TAP1 or TAP2 mutations develop chronic bacterial infections of the sinus and bronchi in late childhood and/or granulomatous skin lesions, but no severe combined immunodeficiency, diarrhea, nor persistent systemic infections (10;11). The mutation in rose2 mice occurs in the conserved Walker B motif of ABC transporters, which is critical for positioning the hydrolytic water molecule in the ATPase site. The mutated aspartic acid is conserved in TAP molecules across species (human, mouse, chicken, and shark), and in many ABC transporter family members (12). The mutation abrogates TAP-dependent peptide transport. The loss of CD8⁺ T cells is due to death after failure to interact with peptide-MHC class I, which is known to promote the development and maintenance of these T cells.

Primers

PCR Primer
rose2_pcr_F: AGGTATGTGTGCCTATGTGAATGTA
rose2_pcr_R: TCAGGGAGATGACACAGCAG

Sequencing Primer
rose2_seq_F: ATATGCCTATGTGAGTACGTATGTG
rose2_seq_R: GATGACACAGCAGGGTGAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 588 nucleotides is amplified (chromosome 17, + strand):

1   aggtatgtgt gcctatgtga atgtatgttt atgtgtgtgt atatgcctat gtgagtacgt
61  atgtgtgtgc ctgtgtatgt atgtgtgtat gtatgtgtct gtgttatgtg agtgtgtatg
121 tatgtgtgta tgtatgtatg tgaatatata tatgtgtgcc tgtgtatgta tgtgtgtatg
181 tatgtgagta tatatatgtg tgtgtggctg tgtatgtata tgagtgtgta tgtgtgctgt
241 gtatgtgtac acaactatct acatctcagc tggactcttg tctctgcaga ggtaggtgag
301 actgggaacc agctgtcagg aggtcagcga caggcagtgg ccttggcccg agccttgatc
361 cggaagccac tcctgcttat cttggatgat gccaccagtg ccctggatgc tggcaaccag
421 ctacgggtaa ggttctggct ctcacccttt gtctttttga gccatcttgc tatgtgatct
481 tggctggcct ggacctcact ttgaagacaa tgctggtctc agacccttgg tagtcttcct
541 gctgctacct ctggagggct gggtcaccct gctgtgtcat ctccctga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Borst, P., and Elferink, R. O. (2002) Mammalian ABC Transporters in Health and Disease. Annu Rev Biochem. 71, 537-592.

  3. Higgins, C. F. (1992) ABC Transporters: From Microorganisms to Man. Annu Rev Cell Biol. 8, 67-113.

  4. Biemans-Oldehinkel, E., Doeven, M. K., and Poolman, B. (2006) ABC Transporter Architecture and Regulatory Roles of Accessory Domains. FEBS Lett. 580, 1023-1035.

  5. Schrodt, S., Koch, J., and Tampe, R. (2006) Membrane Topology of the Transporter Associated with Antigen Processing (TAP1) within an Assembled Functional Peptide-Loading Complex. J Biol Chem. 281, 6455-6462.

  6. Koch, J., Guntrum, R., Heintke, S., Kyritsis, C., and Tampe, R. (2004) Functional Dissection of the Transmembrane Domains of the Transporter Associated with Antigen Processing (TAP). J Biol Chem. 279, 10142-10147.

  7. Procko, E., Raghuraman, G., Wiley, D. C., Raghavan, M., and Gaudet, R. (2005) Identification of Domain Boundaries within the N-Termini of TAP1 and TAP2 and their Importance in Tapasin Binding and Tapasin-Mediated Increase in Peptide Loading of MHC Class I. Immunol Cell Biol. 83, 475-482.

8. de la Salle, H., Zimmer, J., Fricker, D., Angenieux, C., Cazenave, J. P., Okubo, M., Maeda, H., Plebani, A., Tongio, M. M., Dormoy, A., and Hanau, D. (1999) HLA Class I Deficiencies due to Mutations in Subunit 1 of the Peptide Transporter TAP1. J. Clin. Invest. 103, R9-R13.

9. Furukawa, H., Murata, S., Yabe, T., Shimbara, N., Keicho, N., Kashiwase, K., Watanabe, K., Ishikawa, Y., Akaza, T., Tadokoro, K., Tohma, S., Inoue, T., Tokunaga, K., Yamamoto, K., Tanaka, K., and Juji, T. (1999) Splice Acceptor Site Mutation of the Transporter Associated with Antigen Processing-1 Gene in Human Bare Lymphocyte Syndrome. J. Clin. Invest. 103, 755-758.

10. Zimmer, J., Andres, E., Donato, L., Hanau, D., Hentges, F., and de la Salle, H. (2005) Clinical and Immunological Aspects of HLA Class I Deficiency. QJM. 98, 719-727.

11. Lankat-Buttgereit, B., and Tampe, R. (2002) The Transporter Associated with Antigen Processing: Function and Implications in Human Diseases. Physiol. Rev. 82, 187-204.

12. Theodoratos, A., Whittle, B., Enders, A., Tscharke, D. C., Roots, C. M., Goodnow, C. C., and Fahrer, A. M. (2010) Mouse Strains with Point Mutations in TAP1 and TAP2. Immunol Cell Biol. 88, 72-78.