Phenotypic Mutation 'Impaired' (pdf version)
AlleleImpaired
Mutation Type missense
Chromosome8
Coordinate22,666,020 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Ikbkb
Gene Name inhibitor of kappaB kinase beta
Synonym(s) IKK2, IKK[b], IKKbeta, IKK-beta, IKK-2
Chromosomal Location 22,659,212-22,706,589 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit liver degeneration and die in midgestation. Conditional mutations that lack gene expression in lymphoid cells or epidermal keratinocytes exhibit B and T cell deficits and skin inflammation, respectively. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001159774, NM_010546; MGI:1338071

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000033939] [ENSMUSP00000064235] [ENSMUSP00000138156] [ENSMUSP00000120049] [ENSMUSP00000138378]
SMART Domains Protein: ENSMUSP00000033939
Gene: ENSMUSG00000031537
AA Change: L570P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 1.2e-38 PFAM
Pfam:Pkinase 15 296 1.2e-54 PFAM
Pfam:Kdo 31 176 1.3e-7 PFAM
IKKbetaNEMObind 705 742 4.71e-16 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000033939)
SMART Domains Protein: ENSMUSP00000064235
Gene: ENSMUSG00000031537
AA Change: L570P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 7.3e-39 PFAM
Pfam:Pkinase 15 296 6.9e-56 PFAM
Pfam:Kdo 44 177 3e-8 PFAM
IKKbetaNEMObind 705 737 1.83e-4 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000063401)
SMART Domains Protein: ENSMUSP00000138156
Gene: ENSMUSG00000031537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Predicted Effect probably benign
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000138378
Gene: ENSMUSG00000031537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
125-03 Response - decreased
IgE response to a Cysteine Protease (Papain) - decreased
IgG1 response to a Cysteine Protease (Papain) - decreased
MCMV susceptibility
post-MCMV FACS B1a cells in B1 cells - decreased
post-MCMV FACS B1b cells in B1 cells - increased
post-MCMV FACS CD4:CD8 - increased
post-MCMV FACS CD44+ CD4 MFI - decreased
post-MCMV FACS CD44+ CD8 MFI - decreased
post-MCMV FACS CD44+ CD8 T cells - decreased
post-MCMV FACS CD44+ T MFI - decreased
post-MCMV FACS CD8+ T cells - decreased
post-MCMV FACS CD8a+ DCs (gated in CD11c+ cells) - increased
post-MCMV FACS effector memory CD4 T cells in CD4 T cells - decreased
post-MCMV FACS effector memory CD8 T cells in CD8 T cells - decreased
TLR signaling defect: hyposensitivity to MALP2
Penetrance  
Alleles Listed at MGI

All mutations/alleles(15) : Gene trapped(2) Targeted(12) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Ikbkb APN 8 22706111 missense probably damaging 0.99
IGL00899:Ikbkb APN 8 22660447 missense possibly damaging 0.84
IGL02271:Ikbkb APN 8 22665903 missense probably benign 0.00
IGL02569:Ikbkb APN 8 22693883 missense probably damaging 1.00
IGL02610:Ikbkb APN 8 22675072 critical splice acceptor site probably null
IGL03085:Ikbkb APN 8 22682786 missense probably benign 0.03
R0110:Ikbkb UTSW 8 22671635 nonsense probably null
R0366:Ikbkb UTSW 8 22695260 splice site probably benign
R0469:Ikbkb UTSW 8 22671635 nonsense probably null
R0510:Ikbkb UTSW 8 22671635 nonsense probably null
R1386:Ikbkb UTSW 8 22665617 missense possibly damaging 0.69
R1436:Ikbkb UTSW 8 22673403 missense probably benign 0.24
R1645:Ikbkb UTSW 8 22691066 missense probably damaging 0.98
R1695:Ikbkb UTSW 8 22673480 missense probably benign 0.00
R2118:Ikbkb UTSW 8 22667217 splice site probably benign
R2120:Ikbkb UTSW 8 22667217 splice site probably benign
R2121:Ikbkb UTSW 8 22667217 splice site probably benign
R2124:Ikbkb UTSW 8 22666020 missense probably damaging 1.00
R2124:Ikbkb UTSW 8 22667217 splice site probably benign
R2148:Ikbkb UTSW 8 22682745 missense probably damaging 1.00
R2179:Ikbkb UTSW 8 22681753 critical splice acceptor site probably null
R2897:Ikbkb UTSW 8 22669677 missense possibly damaging 0.71
R3861:Ikbkb UTSW 8 22678836 missense possibly damaging 0.94
R4019:Ikbkb UTSW 8 22671712 missense probably benign 0.03
R4723:Ikbkb UTSW 8 22669607 missense probably benign 0.24
R4962:Ikbkb UTSW 8 22681677 missense probably damaging 1.00
R5715:Ikbkb UTSW 8 22678850 missense probably damaging 1.00
R6738:Ikbkb UTSW 8 22675036 missense probably damaging 1.00
R6875:Ikbkb UTSW 8 22665893 missense probably damaging 0.99
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 038233-MU
Last Updated 2018-11-20 1:17 PM by Bruce Beutler
Record Created 2015-05-29 12:39 PM by Jeff SoRelle
Record Posted 2015-11-10
Phenotypic Description
Figure 1. Impaired mice exhibited an increased viral titer in the liver after infection with mouse cytomegalovirus (MCMV).  Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Impaired phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2124, some of which exhibited an increased viral titer in the liver (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased MCMV viral titer in the liver using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 89 mutations (X-axis) identified in the G1 male of pedigree R2124.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 89 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Ikbkb:  a T to C transition at base pair 22,666,020 (v38) on chromosome 8, or base pair 40,566 in the GenBank genomic region NC_000074. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from eight homozygous reference mice and 13 heterozygous mice with a P value of 0.000232 (Figure 2).  

 

The mutation corresponds to residue 1,841 in the mRNA sequence NM_001159774 (variant 1) within exon 17 of 22 total exons and to residue 1,841 in the mRNA sequence NM_010546 (variant 2) within exon 17 of 21 total exons.

 

1825 GAACAAGCGAGGGAGCTCTACCGAAGACTCAGG

565  -E--Q--A--R--E--L--Y--R--R--L--R-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at position 570 (L570P) in both isoforms of the inhibitor of kappa-B kinase-β (IKK-β; alternatively, IKK-2) protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1).

Protein Prediction
Figure 3. Protein domain organization of IKK-2. IKK-2 has a kinase domain, C-terminal dimerization domain (SDD), a leucine zipper, a helix-loop-helix (HLH) domain, and a NEMO binding domain (NBD). The mutation in Impaired mice results in a leucine (L) to proline (P) substitution at position 570.

IKK-2 is a component of the IKK complex, which is necessary for NF-κB activation. The IKK complex is composed of two highly homologous catalytic subunits (IKK-1 (alternatively, IKK-α) and IKK-2), the regulatory subunit NEMO (or IKK-γ; see the record for panr2) that links the catalytic subunits to upstream activators and signaling complexes, and less well-characterized accessory proteins such as HSP90, Cdc37, and ELKS [for review see (2;3)]. 

 

Similar to IKK-1, IKK-2 has a kinase domain (amino acids 15-300), a C-terminal α-helical scaffold/dimerization domain (SDD; amino acids 408-664) that mediates homo- and heterodimerization of IKK-2, a leucine zipper (LZ; amino acids 458-479), a helix-loop-helix (HLH) region (amino acids 603-642), and a NEMO binding domain (NBD; amino acids 737-742) (Figure 3) (4;5). Unique to IKK-2 is a ubiquitin-like domain (ULD; amino acids 307-384), which is essential for the kinase activity of IKK-2 (6;7). Mutations within the ULD result in an inability of the IKK complex to activate NF-κB in response IL-1 and TNF (see the record for Panr1). Leu353 within the ULD is required for the dissociation of IKK-2 from the p65 NF-κB subunits after the phosphorylation and degradation of IκBα. Both the ULD and the SDD mediate the exact positioning of the IκBα substrate.

 

The crystal structure of human IKK-2 (amino acids 1-664) has been solved [PDB: 4KIK; (4)]. IKK-2 has a trimodular structure. The IKK-2 kinase domain has a bilobal kinase fold, while the ULD has a ubiquitin fold. The SDD has a helical blade structure of six α-helices (α1s–α6s) (4). The kinase domain and the ULD are tightly aligned along the N-terminal end of the SDD. The alignment is stabilized by van der Waals and hydrogen bonds between the three domains (4). The structure of the active and inactive kinase domains are slightly different. The most apparent differences are in the conformations of the N-terminal lobe and the activation loop. In the phosphorylated activation loop structure (protomer B), the activation loop exhibits a conformation similar to an active kinase. In the unphosphorylated loop structure (protomer A), the structure is less well defined. Activated IKK-2 dimers switch to a more open V-shaped conformation that facilitates oligomerization and kinase domain interactions, which promotes trans-autophosphorylation (5).

 

IKK-2 undergoes several post-translational modifications. Within the kinase domain activation loop of both IKK-1 and IKK-2 is a MEK consensus motif (SxxxS; S177 and S181 in human and mouse IKK-2). Phosphorylation of IKK-2 on Ser177 and Ser181 is essential for its function and is predicted to result in a conformational change to the activation loop, causing the kinase domain to be catalytically active (8-10). IKK-2 can be phosphorylated by TAK1, a MAPKK that functions in both NF-κB-associated signaling and c-Jun N-terminal kinase (JNK) signaling. The serine/threonine kinase RIP1 phosphorylates IKK upon TNF-mediated IKK activation (11;12). MEKK3 also phosphorylates IKK-2 upon TNF-mediated IKK activation (13). Autophosphorylation of IKK-2 at a serine cluster between the HLH motif and its C-terminus results in negative regulation of IKK activity (14), while phosphorylation of Tyr188/199 is essential for the activation of IKK-2 (15). IKK-2 undergoes non-degradative K63-linked polyubiquitination, a modification necessary for IKK complex activation. TRAF6 catalyzes ubiquitination of IKK in NF-κB-stimulating signaling pathways. TNFα signaling does not depend on K63-linked ubiquitination. The catalytic activity of IKK-2 is increased upon modification with an O-linked N-acetyl glucosamine.

 

The Impaired mutation results in a leucine to proline substitution at amino acid 570 within an undefined domain in the IKK-2 protein.

Expression/Localization

IKK-2 is ubiquitously expressed and is localized to the cytoplasm (16).

Background
Figure 4. Canonical and non-canonical NF-κB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor), IL-1R (interleukin-1 receptor) and TLRs (toll-like receptors), signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). Ubiquitination can be inhibited by deubiquitinating enzymes (DUB). Stimulation of the T-cell receptor (TCR) and B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-βR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression (Figure 4). NF-κB regulates both innate and adaptive immune responses, including those mediated by the toll-like receptors (TLRs), TNF receptors, the IL-1 receptor, and the B and T cell receptors (BCR and TCR, respectively). The NF-κB family of transcription factors consists of the evolutionary conserved proteins p65/RelA, c-Rel, RelB, p50 (derived from the p105 precursor; see the record for Finlay) and p52 (derived from the p100 precursor; see the record for xander). In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with IκB inhibitory molecules, including p105 and p100. IκBs are phosphorylated by the IKK complex at conserved serine residues in response to stimulation (3). This modification induces the K48-linked polyubiquitination of IκB molecules and subsequent recognition by the 26S proteasome as substrates for proteolysis.  Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including various cytokines [for review see (17)].

 

Genetic studies have demonstrated that the IKK-2 and NEMO subunits of IKK are required for NF-κB activation by most stimuli (i.e., canonical stimulation) including inflammatory cytokines (IL-1 and TNFα), endotoxins (e.g., lipopolysaccharide), viral infection, exposure to double-strand RNA, and UV-irradiation (18). Other stimuli, including stimulation of the BCR for (B cell-activating factor; see the record for Frozen), lymphotoxin-β (LTβ; see the record for kama) and CD40 (see the record for walla), may target an IKK-1-containing complex through NF-κB inducing (NIK) kinase (non-canonical stimulation; see the record for lucky) [(19); for review see (20)]. Although NEMO binds preferentially to IKK-2, it can interact with IKK-1 (21), providing some functional redundancy between the two kinases (22)

 

In addition to activating the canonical NF-κB pathway, IKK-2 and NEMO are necessary to activate the tumor progression locus 2 (TPL2; see the record for Sluggish), a MAP3 kinase that activates the MEK/ERK pathway in response to TLR, TNF-α, and CD40 signaling (23). The IKK complex also plays an important role in the production of type I IFNs upstream of the IKK-related kinases IKK-i/ε and TANK-binding kinase 1 (TBK1; see the record for Pioneer), and downstream of the RNA helicase RIG-I, which detects RNA virus infection intracellularly (24).   

 

BCR and TCR-induced NF-κB activation requires costimulatory signals and requires the formation of a lipid raft-associated multiprotein complex that includes the scaffolding proteins CARD11 (see the record for king), Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; see the record for mousebird) (25-27). Similar to the TLR pathway, TRAF6 is required downstream of the Bcl10 complex in order to ubiquitinate NEMO at various lysine residues, which is necessary for IKK complex activation (28-30). In contrast, both the tumor suppressor CYLD (downstream of TNF) and the NF-κB inhibitor A20 (downstream of TNF and TCR signaling; see the record for lasvegas) have been shown to deubiquitinate NEMO and down-regulate NF-κB activation (31-33).

 

IKK-2 is essential for protecting macrophages (34), osteoclasts (35), and gut epithelium (36) from apoptosis triggered by TLR signals. IKK-2 has a pro-apoptotic role in neurons (37). In macrophages, IKK-2 is essential for the synthesis of inflammatory cytokines (38), while in osteoclasts it functions in inflammation-induced bone loss (35). IKK-2 also functions in the development of obesity-induced insulin resistance, because IKK-2-dependent production of myeloid cell inflammatory molecules is necessary for the onset of type II diabetes (39).

 

Alternative substrates

The IKK proteins phosphorylate substrates that have functions in tumor suppression, immunity, cell proliferation, and chromatin remodeling (Table 1). For example, IKK-2-mediated phosphorylation of β-catenin induces the ubiquitin-dependent degradation of β-catenin, while IKK-1-mediated phosphorylation of β-catenin stabilizes β-catenin (40;41). IKK2 also phosphorylates the BH3-oly protein BAD, which stimulates its inactivation and the suppression of TNFα-induced apoptosis (42). In instances of oxidative stress, IKK-2 can also phosphorylate S6K1 to promote apoptosis (43). The IKK complex can also induce the phosphorylation of the p85 subunit of PI3K to subsequently block Akt and mTOR inhibition in the case of nutrient depletion (44). IKK-2 can regulate the TSC1/2 and FOXO3a tumor suppressors. In breast cancer cells, TNFα-induced IKK-2 phosphorylates TSC1, leading to the disruption of the TSC1/2 tumor suppressor complex and subsequent activation of the mTOR pathway. IKK-2-mediated TSC1 phosphorylation and VEGF production in breast cancer patients correlates with a poor clinical outcome (45). In contrast, FOXO3a expression is inversely correlated with IKK-2 and is positively correlated with survival rate in breast cancer. In addition, p53 was identified as an IKK-2 substrate. IKK-2-mediated phosphorylation of p53 affects p53 stability (46).

 

Table 1. IKK-2-interacting proteins

Substrate

IKK-2-related effect

References

IKK-2

IκB degradation and subsequent transcription of NF-κB target genes

(9)

IKK-1

(8;9;47)

NEMO

 

Hsp90/Hsp70

Hsp90 prevents misfolding of substrates and subsequent proteasomal degradation; required for IKK-2 activation

(48)

Cdc37

 

IκBα/IκBβ

Transcription of NF-κB target genes

 

RelA/p65

(49)

NIK (NF-κB inducing kinase; see the record for lucky)

Transcription of NF-κB target genes

(8)

P53

P53 destabilization and promotion of p53 degradation by the β-TrCP pathway

(46)

TSC1/2

TSC1/2 suppression, induction of mTOR activation

(45)

FOXO3a

Promotes FOXO3a proteasomal degradation

(50)

Aurora A

Promotes Aurora A degradation by the β-TrCP pathway

(51)

14-3-3β

Stabilization of 14-3-3β-associated mRNAs; positive feedback loop for the NF-κB pathway

(52)

BAD

Promotes BAD inactivation and the suppression of TNFα-induced apoptosis

(42)

S6K1

Promotes apoptosis

(43)

P85 subunit of PI3K

Blocks Akt and mTOR inhibition upon nutrient depletion

(44)

SRC-3

Increases pro-inflammatory gene expression

(53)

Bcl10 and CARMA (see the record for king)

Required for formation of the Carma1/Bcl10/MALT1 complex; antigen receptor-induced NF-κB activation

(54;55)

P105 (see the record for Finlay)

Activates MEK and MAPK pathways via p105 proteolysis

(23)

Dok1

Suppresses MAPK Dok1 phosphorylation that inhibits ERK1/2

(56)

IRS-1

Antagonizes insulin signaling downstream of IRS-1

(57)

SNAP-23

Promotes mast cell degranulation upon FcεRI stimulation

(58)

 

Human conditions associated with IKBKB

Mutations in IKBKB has been linked to immunodeficiency 15 (IMD15; OMIM: #615592) (59;60). IMD15 is characterized by early-onset bacterial, fungal, and viral infections as well as a failure to thrive. Patients with IMD15 exhibit hypo- or agammaglobulinemia with relatively normal numbers of B and T cells. Differentiation and activation of immune cells in patients with IMD15 are impaired (60).

Putative Mechanism

Ikbkb-deficient (Ikbkb-/-) mice are embryonically lethal by embryonic day 13 (E13), mainly due to TNF-induced hepatocyte apoptosis (61;62). The Ikbkb-/- mice exhibit reduced basal and cytokine-induced NF-κB activation (62). Tissue-specific deletion of IKK complex components has provided further understanding of the role NF-κB activation plays in several cell and tissue types including B cells, T cells, gut epithelium, and liver. B-cell-specific knockouts of both IKK-2 and NEMO resulted in a lack of B cells in the spleen, suggesting that canonical NF-κB activation is required for the maintenance of mature B cells (63), while the development of B cells is dependent on non-canonical NF-κB activation by IKK-1 and NIK (64;65). IKK-2 function in follicular and marginal zone B cells is essential for B cell development (63). B cell specific deletion of Ikbkb resulted in reduced frequencies of peripheral B cells due to defects in cell survival (66). In addition, immune responses to LPS, anti-CD40, and anti-IgM were impaired compared to that in wild-type mice (66). Mice with T-cell-restricted NEMO ablation or with replacement of IKK-2 with a kinase-dead mutant prevented survival of peripheral T cells (67). In addition, IKK-2 in T cells is essential for the development of natural killer T (NKT) cells and CD4+/CD25+ regulatory T cells (68). Ablation of NEMO or both IKK-1 and IKK-2 in gut epithelium caused severe chronic intestinal inflammation in mice, suggesting that NF-κB activation is required to control epithelial integrity and the interaction between the mucosal immune system and gut microflora. In this model, MyD88 or TNFR1 deficiency prevented the development of intestinal inflammation, demonstrating that TLR activation by intestinal bacteria and TNF-α signaling is essential for the development of intestinal inflammation caused by NF-κB inactivation (69). Epidermis-specific deletion of Ikbkb resulted in severe inflammatory skin disease shortly after birth (70). Targeted deletion of Ikbkb in skeletal muscle resulted in a shift in muscle fiber distribution with a concomitant improvement in muscle force and protection against atrophy (71). Lung epithelial cell-specific depletion of Ikbkb resulted in delayed onset of Th17 and B cell responses as well as delayed fungal clearance in the lung upon infection with pneumocystis (72). Intestinal epithelium-specific depletion of Ikbkb prevented sepsis-induced increases in apoptosis and permeability (73). Finally, in a mouse model of multiple sclerosis, CNS-specific ablation of IKK-2 or NEMO ameliorated the disease by preventing the expression of NF-κB regulated inflammatory cytokines and other molecules (74). The phenotypes seen in NEMO-deficient, IKK-2, and IKK-1 knockout mice are partially recapitulated by the transgenic overexpression of repressor or dominant-negative proteins of NF-κB activation [reviewed in (20)]. 

 

The Impaired mice did not exhibit defects in B cell or T cell frequencies in the peripheral blood under normal conditions, indicating that IKK-2Impaired retains some function in B and T cells. IKK-2 is known to be required for NF-κB activation after viral infection (18). The IKK subunits are known to have essential roles in allergy, inflammation, and immunity. In mast cells, IgE stimulation through the FcεRI triggers degranulation and anaphylactic reactions. IKK-2 induces IgE-mediated degranulation by phosphorylating SNAP-23 independent of the NF-κB signaling pathway (58). IKK-2 also regulates late-phase allergic reactions through the release of proinflammatory cytokines in a NF-κB-dependent manner (58). In mice that have mast cell-specific deletion of Ikbkb, IgE-induced late-phase cytokine responses were reduced; however, degranulation of the mast cells was not affected (75).  ELKS is predicted to also function in mast cell degranulation.

Primers PCR Primer
Impaired(F):5'- AAGCTTTGGATTGCCTGAAGC -3'
Impaired(R):5'- CTCTTGTAGCTAAGCAGAAGAGGAC -3'

Sequencing Primer
Impaired_seq(F):5'- TGAAGCAGCAGCCGTAC -3'
Impaired_seq(R):5'- AGAGGACTGTAATCTTTAAGGCTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Takuma Misawa, Zhe Chen