Phenotypic Mutation 'Impaired' (pdf version)
Allele | Impaired |
Mutation Type |
missense
|
Chromosome | 8 |
Coordinate | 23,156,036 bp (GRCm39) |
Base Change | A ⇒ G (forward strand) |
Gene |
Ikbkb
|
Gene Name | inhibitor of kappaB kinase beta |
Synonym(s) | IKK[b], IKK-beta, IKK-2, IKK2, IKKbeta |
Chromosomal Location |
23,149,228-23,196,605 bp (-) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011] PHENOTYPE: Homozygotes for targeted null mutations exhibit liver degeneration and die in midgestation. Conditional mutations that lack gene expression in lymphoid cells or epidermal keratinocytes exhibit B and T cell deficits and skin inflammation, respectively. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_001159774, NM_010546; MGI:1338071
|
Mapped | Yes |
Amino Acid Change |
Leucine changed to Proline
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000033939]
[ENSMUSP00000064235]
[ENSMUSP00000138156]
[ENSMUSP00000120049]
[ENSMUSP00000138378]
|
AlphaFold |
no structure available at present |
SMART Domains |
Protein: ENSMUSP00000033939 Gene: ENSMUSG00000031537 AA Change: L570P
Domain | Start | End | E-Value | Type |
Pfam:Pkinase_Tyr
|
15 |
247 |
1.2e-38 |
PFAM |
Pfam:Pkinase
|
15 |
296 |
1.2e-54 |
PFAM |
Pfam:Kdo
|
31 |
176 |
1.3e-7 |
PFAM |
IKKbetaNEMObind
|
705 |
742 |
4.71e-16 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000033939)
|
SMART Domains |
Protein: ENSMUSP00000064235 Gene: ENSMUSG00000031537 AA Change: L570P
Domain | Start | End | E-Value | Type |
Pfam:Pkinase_Tyr
|
15 |
247 |
7.3e-39 |
PFAM |
Pfam:Pkinase
|
15 |
296 |
6.9e-56 |
PFAM |
Pfam:Kdo
|
44 |
177 |
3e-8 |
PFAM |
IKKbetaNEMObind
|
705 |
737 |
1.83e-4 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000063401)
|
SMART Domains |
Protein: ENSMUSP00000138156 Gene: ENSMUSG00000031537
Domain | Start | End | E-Value | Type |
Pfam:Pkinase_Tyr
|
15 |
248 |
2.8e-38 |
PFAM |
Pfam:Pkinase
|
15 |
296 |
2.5e-55 |
PFAM |
Pfam:Kdo
|
43 |
177 |
1.4e-7 |
PFAM |
|
Predicted Effect |
probably benign
|
Predicted Effect |
probably benign
|
SMART Domains |
Protein: ENSMUSP00000138378 Gene: ENSMUSG00000031537
Domain | Start | End | E-Value | Type |
Pfam:Pkinase_Tyr
|
15 |
248 |
2.8e-38 |
PFAM |
Pfam:Pkinase
|
15 |
296 |
2.5e-55 |
PFAM |
Pfam:Kdo
|
43 |
177 |
1.4e-7 |
PFAM |
|
Predicted Effect |
probably benign
|
Meta Mutation Damage Score |
0.8724 |
Is this an essential gene? |
Essential (E-score: 1.000) |
Phenotypic Category |
Autosomal Semidominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All mutations/alleles(15) : Gene trapped(2) Targeted(12) Transgenic(1)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00095:Ikbkb
|
APN |
8 |
23196127 |
missense |
probably damaging |
0.99 |
IGL00899:Ikbkb
|
APN |
8 |
23150463 |
missense |
possibly damaging |
0.84 |
IGL02271:Ikbkb
|
APN |
8 |
23155919 |
missense |
probably benign |
0.00 |
IGL02569:Ikbkb
|
APN |
8 |
23183899 |
missense |
probably damaging |
1.00 |
IGL02610:Ikbkb
|
APN |
8 |
23165088 |
critical splice acceptor site |
probably null |
|
IGL03085:Ikbkb
|
APN |
8 |
23172802 |
missense |
probably benign |
0.03 |
Baby
|
UTSW |
8 |
23165052 |
missense |
probably damaging |
1.00 |
Kiki
|
UTSW |
8 |
23161658 |
missense |
possibly damaging |
0.95 |
R0110:Ikbkb
|
UTSW |
8 |
23161651 |
nonsense |
probably null |
|
R0366:Ikbkb
|
UTSW |
8 |
23185276 |
splice site |
probably benign |
|
R0469:Ikbkb
|
UTSW |
8 |
23161651 |
nonsense |
probably null |
|
R0510:Ikbkb
|
UTSW |
8 |
23161651 |
nonsense |
probably null |
|
R1386:Ikbkb
|
UTSW |
8 |
23155633 |
missense |
possibly damaging |
0.69 |
R1436:Ikbkb
|
UTSW |
8 |
23163419 |
missense |
probably benign |
0.24 |
R1645:Ikbkb
|
UTSW |
8 |
23181082 |
missense |
probably damaging |
0.98 |
R1695:Ikbkb
|
UTSW |
8 |
23163496 |
missense |
probably benign |
0.00 |
R2118:Ikbkb
|
UTSW |
8 |
23157233 |
splice site |
probably benign |
|
R2120:Ikbkb
|
UTSW |
8 |
23157233 |
splice site |
probably benign |
|
R2121:Ikbkb
|
UTSW |
8 |
23157233 |
splice site |
probably benign |
|
R2124:Ikbkb
|
UTSW |
8 |
23157233 |
splice site |
probably benign |
|
R2124:Ikbkb
|
UTSW |
8 |
23156036 |
missense |
probably damaging |
1.00 |
R2148:Ikbkb
|
UTSW |
8 |
23172761 |
missense |
probably damaging |
1.00 |
R2179:Ikbkb
|
UTSW |
8 |
23171769 |
critical splice acceptor site |
probably null |
|
R2897:Ikbkb
|
UTSW |
8 |
23159693 |
missense |
possibly damaging |
0.71 |
R3861:Ikbkb
|
UTSW |
8 |
23168852 |
missense |
possibly damaging |
0.94 |
R4019:Ikbkb
|
UTSW |
8 |
23161728 |
missense |
probably benign |
0.03 |
R4723:Ikbkb
|
UTSW |
8 |
23159623 |
missense |
probably benign |
0.24 |
R4962:Ikbkb
|
UTSW |
8 |
23171693 |
missense |
probably damaging |
1.00 |
R5715:Ikbkb
|
UTSW |
8 |
23168866 |
missense |
probably damaging |
1.00 |
R6738:Ikbkb
|
UTSW |
8 |
23165052 |
missense |
probably damaging |
1.00 |
R6875:Ikbkb
|
UTSW |
8 |
23155909 |
missense |
probably damaging |
0.99 |
R7054:Ikbkb
|
UTSW |
8 |
23161658 |
missense |
possibly damaging |
0.95 |
R7284:Ikbkb
|
UTSW |
8 |
23158976 |
missense |
probably benign |
0.32 |
R7383:Ikbkb
|
UTSW |
8 |
23159066 |
missense |
probably benign |
|
R7633:Ikbkb
|
UTSW |
8 |
23161757 |
missense |
probably benign |
0.08 |
R7768:Ikbkb
|
UTSW |
8 |
23185252 |
missense |
probably damaging |
0.99 |
R7819:Ikbkb
|
UTSW |
8 |
23161742 |
missense |
probably benign |
0.05 |
R8332:Ikbkb
|
UTSW |
8 |
23155641 |
missense |
possibly damaging |
0.79 |
R8369:Ikbkb
|
UTSW |
8 |
23181097 |
missense |
probably benign |
0.32 |
R8421:Ikbkb
|
UTSW |
8 |
23168804 |
critical splice donor site |
probably null |
|
R8934:Ikbkb
|
UTSW |
8 |
23150407 |
makesense |
probably null |
|
R9249:Ikbkb
|
UTSW |
8 |
23171735 |
nonsense |
probably null |
|
R9352:Ikbkb
|
UTSW |
8 |
23150444 |
missense |
probably benign |
|
R9367:Ikbkb
|
UTSW |
8 |
23171711 |
missense |
probably damaging |
1.00 |
R9524:Ikbkb
|
UTSW |
8 |
23172740 |
critical splice donor site |
probably null |
|
R9581:Ikbkb
|
UTSW |
8 |
23155575 |
missense |
probably damaging |
0.99 |
R9588:Ikbkb
|
UTSW |
8 |
23151410 |
missense |
unknown |
|
|
Mode of Inheritance |
Autosomal Semidominant |
Local Stock | Live Mice, Sperm, gDNA |
MMRRC Submission |
038233-MU
|
Last Updated |
2019-09-04 9:45 PM
by Diantha La Vine
|
Record Created |
2015-05-29 12:39 PM
by Jeff SoRelle
|
Record Posted |
2019-04-05 |
Phenotypic Description |
The Impaired phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2124, some of which exhibited an increased viral titer in the liver after infection with mouse cytomegalovirus (MCMV) (Figure 1). Some mice also exhibited an increased CD4+ to CD8+ T cell ratio (Figure 2) caused by a diminished frequency of peripheral CD8+ T cells in CD3+ T cells in the peripheral blood after exposure to MCMV (Figure 3). Some mice also exhibited a reduced frequency of B1a cells in B1 cells (Figure 4) and an increased frequency of B1b cells in B1 cells (Figure 5) in the peripheral blood after MCMV infection.
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 89 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Ikbkb: a T to C transition at base pair 22,666,020 (v38) on chromosome 8, or base pair 40,566 in the GenBank genomic region NC_000074. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from eight homozygous reference mice and 13 heterozygous mice with a P value of 0.000232 (Figure 6). The mutation corresponds to residue 1,841 in the mRNA sequence NM_001159774 (variant 1) within exon 17 of 22 total exons and to residue 1,841 in the mRNA sequence NM_010546 (variant 2) within exon 17 of 21 total exons.
1825 GAACAAGCGAGGGAGCTCTACCGAAGACTCAGG
565 -E--Q--A--R--E--L--Y--R--R--L--R-
|
The mutated nucleotide is indicated in red. The mutation results in a leucine (L) to proline (P) substitution at position 570 (L570P) in both isoforms of the inhibitor of kappa-B kinase-β (IKK-β; alternatively, IKK-2) protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
IKK-2 is a component of the IKK complex, which is necessary for NF-κB activation. The IKK complex is composed of two highly homologous catalytic subunits (IKK-1 (alternatively, IKK-α) and IKK-2), the regulatory subunit NEMO (or IKK-γ; see the record for panr2) that links the catalytic subunits to upstream activators and signaling complexes, and less well-characterized accessory proteins such as HSP90, Cdc37, and ELKS [for review see (2;3)]. Similar to IKK-1, IKK-2 has a kinase domain (amino acids 15-300), a C-terminal α-helical scaffold/dimerization domain (SDD; amino acids 408-664) that mediates homo- and heterodimerization of IKK-2, a leucine zipper (LZ; amino acids 458-479), a helix-loop-helix (HLH) region (amino acids 603-642), and a NEMO binding domain (NBD; amino acids 737-742) (Figure 7) (4;5). Unique to IKK-2 is a ubiquitin-like domain (ULD; amino acids 307-384), which is essential for the kinase activity of IKK-2 (6;7). Mutations within the ULD result in an inability of the IKK complex to activate NF-κB in response IL-1 and TNF (see the record for Panr1). Leu353 within the ULD is required for the dissociation of IKK-2 from the p65 NF-κB subunits after the phosphorylation and degradation of IκBα. Both the ULD and the SDD mediate the exact positioning of the IκBα substrate. The crystal structure of human IKK-2 (amino acids 1-664) has been solved [PDB: 4KIK; (4)]. IKK-2 has a trimodular structure. The IKK-2 kinase domain has a bilobal kinase fold, while the ULD has a ubiquitin fold. The SDD has a helical blade structure of six α-helices (α1s–α6s) (4). The kinase domain and the ULD are tightly aligned along the N-terminal end of the SDD. The alignment is stabilized by van der Waals and hydrogen bonds between the three domains (4). The structure of the active and inactive kinase domains are slightly different. The most apparent differences are in the conformations of the N-terminal lobe and the activation loop. In the phosphorylated activation loop structure (protomer B), the activation loop exhibits a conformation similar to an active kinase. In the unphosphorylated loop structure (protomer A), the structure is less well defined. Activated IKK-2 dimers switch to a more open V-shaped conformation that facilitates oligomerization and kinase domain interactions, which promotes trans-autophosphorylation (5). IKK-2 undergoes several post-translational modifications. Within the kinase domain activation loop of both IKK-1 and IKK-2 is a MEK consensus motif (SxxxS; S177 and S181 in human and mouse IKK-2). Phosphorylation of IKK-2 on Ser177 and Ser181 is essential for its function and is predicted to result in a conformational change to the activation loop, causing the kinase domain to be catalytically active (8-10). IKK-2 can be phosphorylated by TAK1, a MAPKK that functions in both NF-κB-associated signaling and c-Jun N-terminal kinase (JNK) signaling. The serine/threonine kinase RIP1 phosphorylates IKK upon TNF-mediated IKK activation (11;12). MEKK3 also phosphorylates IKK-2 upon TNF-mediated IKK activation (13). Autophosphorylation of IKK-2 at a serine cluster between the HLH motif and its C-terminus results in negative regulation of IKK activity (14), while phosphorylation of Tyr188/199 is essential for the activation of IKK-2 (15). IKK-2 undergoes non-degradative K63-linked polyubiquitination, a modification necessary for IKK complex activation. TRAF6 catalyzes ubiquitination of IKK in NF-κB-stimulating signaling pathways. TNFα signaling does not depend on K63-linked ubiquitination. The catalytic activity of IKK-2 is increased upon modification with an O-linked N-acetyl glucosamine. The Impaired mutation results in a leucine to proline substitution at amino acid 570 within an undefined domain in the IKK-2 protein.
|
Expression/Localization | IKK-2 is ubiquitously expressed and is localized to the cytoplasm (16).
|
Background |
The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression (Figure 8). NF-κB regulates both innate and adaptive immune responses, including those mediated by the toll-like receptors (TLRs), TNF receptors, the IL-1 receptor, and the B and T cell receptors (BCR and TCR, respectively). The NF-κB family of transcription factors consists of the evolutionary conserved proteins p65/RelA, c-Rel, RelB, p50 (derived from the p105 precursor; see the record for Finlay) and p52 (derived from the p100 precursor; see the record for xander). In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with IκB inhibitory molecules, including p105 and p100. IκBs are phosphorylated by the IKK complex at conserved serine residues in response to stimulation (3). This modification induces the K48-linked polyubiquitination of IκB molecules and subsequent recognition by the 26S proteasome as substrates for proteolysis. Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including various cytokines [for review see (17)]. Genetic studies have demonstrated that the IKK-2 and NEMO subunits of IKK are required for NF-κB activation by most stimuli (i.e., canonical stimulation) including inflammatory cytokines (IL-1 and TNFα), endotoxins (e.g., lipopolysaccharide), viral infection, exposure to double-strand RNA, and UV-irradiation (18). Other stimuli, including stimulation of the BCR for (B cell-activating factor; see the record for Frozen), lymphotoxin-β (LTβ; see the record for kama) and CD40 (see the record for walla), may target an IKK-1-containing complex through NF-κB inducing (NIK) kinase (non-canonical stimulation; see the record for lucky) [(19); for review see (20)]. Although NEMO binds preferentially to IKK-2, it can interact with IKK-1 (21), providing some functional redundancy between the two kinases (22). In addition to activating the canonical NF-κB pathway, IKK-2 and NEMO are necessary to activate the tumor progression locus 2 (TPL2; see the record for Sluggish), a MAP3 kinase that activates the MEK/ERK pathway in response to TLR, TNF-α, and CD40 signaling (23). The IKK complex also plays an important role in the production of type I IFNs upstream of the IKK-related kinases IKK-i/ε and TANK-binding kinase 1 (TBK1; see the record for Pioneer), and downstream of the RNA helicase RIG-I, which detects RNA virus infection intracellularly (24). BCR and TCR-induced NF-κB activation requires costimulatory signals and requires the formation of a lipid raft-associated multiprotein complex that includes the scaffolding proteins CARD11 (see the record for king), Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; see the record for mousebird) (25-27). Similar to the TLR pathway, TRAF6 is required downstream of the Bcl10 complex in order to ubiquitinate NEMO at various lysine residues, which is necessary for IKK complex activation (28-30). In contrast, both the tumor suppressor CYLD (downstream of TNF) and the NF-κB inhibitor A20 (downstream of TNF and TCR signaling; see the record for lasvegas) have been shown to deubiquitinate NEMO and down-regulate NF-κB activation (31-33). IKK-2 is essential for protecting macrophages (34), osteoclasts (35), and gut epithelium (36) from apoptosis triggered by TLR signals. IKK-2 has a pro-apoptotic role in neurons (37). In macrophages, IKK-2 is essential for the synthesis of inflammatory cytokines (38), while in osteoclasts it functions in inflammation-induced bone loss (35). IKK-2 also functions in the development of obesity-induced insulin resistance, because IKK-2-dependent production of myeloid cell inflammatory molecules is necessary for the onset of type II diabetes (39). Alternative substrates
The IKK proteins phosphorylate substrates that have functions in tumor suppression, immunity, cell proliferation, and chromatin remodeling (Table 1). For example, IKK-2-mediated phosphorylation of β-catenin induces the ubiquitin-dependent degradation of β-catenin, while IKK-1-mediated phosphorylation of β-catenin stabilizes β-catenin (40;41). IKK2 also phosphorylates the BH3-oly protein BAD, which stimulates its inactivation and the suppression of TNFα-induced apoptosis (42). In instances of oxidative stress, IKK-2 can also phosphorylate S6K1 to promote apoptosis (43). The IKK complex can also induce the phosphorylation of the p85 subunit of PI3K to subsequently block Akt and mTOR inhibition in the case of nutrient depletion (44). IKK-2 can regulate the TSC1/2 and FOXO3a tumor suppressors. In breast cancer cells, TNFα-induced IKK-2 phosphorylates TSC1, leading to the disruption of the TSC1/2 tumor suppressor complex and subsequent activation of the mTOR pathway. IKK-2-mediated TSC1 phosphorylation and VEGF production in breast cancer patients correlates with a poor clinical outcome (45). In contrast, FOXO3a expression is inversely correlated with IKK-2 and is positively correlated with survival rate in breast cancer. In addition, p53 was identified as an IKK-2 substrate. IKK-2-mediated phosphorylation of p53 affects p53 stability (46). Table 1. IKK-2-interacting proteins
Substrate
|
IKK-2-related effect
|
References
|
IKK-2
|
IκB degradation and subsequent transcription of NF-κB target genes
|
(9)
|
IKK-1
|
(8;9;47)
|
NEMO
|
|
Hsp90/Hsp70
|
Hsp90 prevents misfolding of substrates and subsequent proteasomal degradation; required for IKK-2 activation
|
(48)
|
Cdc37
|
|
IκBα/IκBβ
|
Transcription of NF-κB target genes
|
|
RelA/p65
|
(49)
|
NIK (NF-κB inducing kinase; see the record for lucky)
|
Transcription of NF-κB target genes
|
(8)
|
P53
|
P53 destabilization and promotion of p53 degradation by the β-TrCP pathway
|
(46)
|
TSC1/2
|
TSC1/2 suppression, induction of mTOR activation
|
(45)
|
FOXO3a
|
Promotes FOXO3a proteasomal degradation
|
(50)
|
Aurora A
|
Promotes Aurora A degradation by the β-TrCP pathway
|
(51)
|
14-3-3β
|
Stabilization of 14-3-3β-associated mRNAs; positive feedback loop for the NF-κB pathway
|
(52)
|
BAD
|
Promotes BAD inactivation and the suppression of TNFα-induced apoptosis
|
(42)
|
S6K1
|
Promotes apoptosis
|
(43)
|
P85 subunit of PI3K
|
Blocks Akt and mTOR inhibition upon nutrient depletion
|
(44)
|
SRC-3
|
Increases pro-inflammatory gene expression
|
(53)
|
Bcl10 and CARMA (see the record for king)
|
Required for formation of the Carma1/Bcl10/MALT1 complex; antigen receptor-induced NF-κB activation
|
(54;55)
|
P105 (see the record for Finlay)
|
Activates MEK and MAPK pathways via p105 proteolysis
|
(23)
|
Dok1
|
Suppresses MAPK Dok1 phosphorylation that inhibits ERK1/2
|
(56)
|
IRS-1
|
Antagonizes insulin signaling downstream of IRS-1
|
(57)
|
SNAP-23
|
Promotes mast cell degranulation upon FcεRI stimulation
|
(58)
|
Human conditions associated with IKBKB
Mutations in IKBKB has been linked to immunodeficiency 15 (IMD15; OMIM: #615592) (59;60). IMD15 is characterized by early-onset bacterial, fungal, and viral infections as well as a failure to thrive. Patients with IMD15 exhibit hypo- or agammaglobulinemia with relatively normal numbers of B and T cells. Differentiation and activation of immune cells in patients with IMD15 are impaired (60).
|
Putative Mechanism | Ikbkb-deficient (Ikbkb-/-) mice are embryonically lethal by embryonic day 13 (E13), mainly due to TNF-induced hepatocyte apoptosis (61;62). The Ikbkb-/- mice exhibit reduced basal and cytokine-induced NF-κB activation (62). Tissue-specific deletion of IKK complex components has provided further understanding of the role NF-κB activation plays in several cell and tissue types including B cells, T cells, gut epithelium, and liver. B-cell-specific knockouts of both IKK-2 and NEMO resulted in a lack of B cells in the spleen, suggesting that canonical NF-κB activation is required for the maintenance of mature B cells (63), while the development of B cells is dependent on non-canonical NF-κB activation by IKK-1 and NIK (64;65). IKK-2 function in follicular and marginal zone B cells is essential for B cell development (63). B cell specific deletion of Ikbkb resulted in reduced frequencies of peripheral B cells due to defects in cell survival (66). In addition, immune responses to LPS, anti-CD40, and anti-IgM were impaired compared to that in wild-type mice (66). Mice with T-cell-restricted NEMO ablation or with replacement of IKK-2 with a kinase-dead mutant prevented survival of peripheral T cells (67). In addition, IKK-2 in T cells is essential for the development of natural killer T (NKT) cells and CD4+/CD25+ regulatory T cells (68). Ablation of NEMO or both IKK-1 and IKK-2 in gut epithelium caused severe chronic intestinal inflammation in mice, suggesting that NF-κB activation is required to control epithelial integrity and the interaction between the mucosal immune system and gut microflora. In this model, MyD88 or TNFR1 deficiency prevented the development of intestinal inflammation, demonstrating that TLR activation by intestinal bacteria and TNF-α signaling is essential for the development of intestinal inflammation caused by NF-κB inactivation (69). Epidermis-specific deletion of Ikbkb resulted in severe inflammatory skin disease shortly after birth (70). Targeted deletion of Ikbkb in skeletal muscle resulted in a shift in muscle fiber distribution with a concomitant improvement in muscle force and protection against atrophy (71). Lung epithelial cell-specific depletion of Ikbkb resulted in delayed onset of Th17 and B cell responses as well as delayed fungal clearance in the lung upon infection with pneumocystis (72). Intestinal epithelium-specific depletion of Ikbkb prevented sepsis-induced increases in apoptosis and permeability (73). Finally, in a mouse model of multiple sclerosis, CNS-specific ablation of IKK-2 or NEMO ameliorated the disease by preventing the expression of NF-κB regulated inflammatory cytokines and other molecules (74). The phenotypes seen in NEMO-deficient, IKK-2, and IKK-1 knockout mice are partially recapitulated by the transgenic overexpression of repressor or dominant-negative proteins of NF-κB activation [reviewed in (20)]. The Impaired mice did not exhibit defects in B cell or T cell frequencies in the peripheral blood under normal conditions, indicating that IKK-2Impaired retains some function in B and T cells. IKK-2 is known to be required for NF-κB activation after viral infection (18). The IKK subunits are known to have essential roles in allergy, inflammation, and immunity. In mast cells, IgE stimulation through the FcεRI triggers degranulation and anaphylactic reactions. IKK-2 induces IgE-mediated degranulation by phosphorylating SNAP-23 independent of the NF-κB signaling pathway (58). IKK-2 also regulates late-phase allergic reactions through the release of proinflammatory cytokines in a NF-κB-dependent manner (58). In mice that have mast cell-specific deletion of Ikbkb, IgE-induced late-phase cytokine responses were reduced; however, degranulation of the mast cells was not affected (75). ELKS is predicted to also function in mast cell degranulation.
|
Primers |
PCR Primer
Impaired_pcr_F: AAGCTTTGGATTGCCTGAAGC
Impaired_pcr_R: CTCTTGTAGCTAAGCAGAAGAGGAC
Sequencing Primer
Impaired_seq_F: TGAAGCAGCAGCCGTAC
Impaired_seq_R: AGAGGACTGTAATCTTTAAGGCTG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 405 nucleotides is amplified (chromosome 8, - strand):
1 ctcttgtagc taagcagaag aggactgtaa tctttaaggc tgttctcgtt tgtggcattt 61 gggttttata aatattacca taactggcag gttttattcc cattgagagc atatgaccag 121 tagtctaaag agtagtgatc cgctggcaag agttagcagg ctggtgctta aatgtccttg 181 gtgtgccttg actctggcct tccctcttcc agagaggaac aagcgaggga gctctaccga 241 agactcaggg agaagccaag aggtacatgc tttgtcttgt ctttgagaca ctggtctacc 301 ctggaggcca gtaggaggaa ctatgccact cccctctgca gaccaaagga cagaaggtga 361 cagccaggag atggtacggc tgctgcttca ggcaatccaa agctt
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References | 1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.
2. Yamaoka, S., Courtois, G., Bessia, C., Whiteside, S. T., Weil, R., Agou, F., Kirk, H. E., Kay, R. J., and Israel, A. (1998) Complementation Cloning of NEMO, a Component of the IkappaB Kinase Complex Essential for NF-kappaB Activation. Cell. 93, 1231-1240.
4. Liu, S., Misquitta, Y. R., Olland, A., Johnson, M. A., Kelleher, K. S., Kriz, R., Lin, L. L., Stahl, M., and Mosyak, L. (2013) Crystal Structure of a Human IkappaB Kinase Beta Asymmetric Dimer. J Biol Chem. 288, 22758-22767.
5. Xu, G., Lo, Y. C., Li, Q., Napolitano, G., Wu, X., Jiang, X., Dreano, M., Karin, M., and Wu, H. (2011) Crystal Structure of Inhibitor of kappaB Kinase Beta. Nature. 472, 325-330.
7. May, M. J., Larsen, S. E., Shim, J. H., Madge, L. A., and Ghosh, S. (2004) A Novel Ubiquitin-Like Domain in IkappaB Kinase Beta is Required for Functional Activity of the Kinase. J Biol Chem. 279, 45528-45539.
8. Woronicz, J. D., Gao, X., Cao, Z., Rothe, M., and Goeddel, D. V. (1997) IkappaB Kinase-Beta: NF-kappaB Activation and Complex Formation with IkappaB Kinase-Alpha and NIK. Science. 278, 866-869.
9. Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J., Young, D. B., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997) IKK-1 and IKK-2: Cytokine-Activated IkappaB Kinases Essential for NF-kappaB Activation. Science. 278, 860-866.
10. Regnier, C. H., Song, H. Y., Gao, X., Goeddel, D. V., Cao, Z., and Rothe, M. (1997) Identification and Characterization of an IkappaB Kinase. Cell. 90, 373-383.
11. Meylan, E., Burns, K., Hofmann, K., Blancheteau, V., Martinon, F., Kelliher, M., and Tschopp, J. (2004) RIP1 is an Essential Mediator of Toll-Like Receptor 3-Induced NF-Kappa B Activation. Nat Immunol. 5, 503-507.
13. Yang, J., Lin, Y., Guo, Z., Cheng, J., Huang, J., Deng, L., Liao, W., Chen, Z., Liu, Z., and Su, B. (2001) The Essential Role of MEKK3 in TNF-Induced NF-kappaB Activation. Nat Immunol. 2, 620-624.
18. Li, Z. W., Chu, W., Hu, Y., Delhase, M., Deerinck, T., Ellisman, M., Johnson, R., and Karin, M. (1999) The IKKbeta Subunit of IkappaB Kinase (IKK) is Essential for Nuclear Factor kappaB Activation and Prevention of Apoptosis. J Exp Med. 189, 1839-1845.
22. Li, Q., Estepa, G., Memet, S., Israel, A., and Verma, I. M. (2000) Complete Lack of NF-kappaB Activity in IKK1 and IKK2 Double-Deficient Mice: Additional Defect in Neurulation. Genes Dev. 14, 1729-1733.
23. Waterfield, M., Jin, W., Reiley, W., Zhang, M., and Sun, S. C. (2004) IkappaB Kinase is an Essential Component of the Tpl2 Signaling Pathway. Mol Cell Biol. 24, 6040-6048.
24. Zhao, T., Yang, L., Sun, Q., Arguello, M., Ballard, D. W., Hiscott, J., and Lin, R. (2007) The NEMO Adaptor Bridges the Nuclear Factor-kappaB and Interferon Regulatory Factor Signaling Pathways. Nat Immunol. 8, 592-600.
25. Gaide, O., Favier, B., Legler, D. F., Bonnet, D., Brissoni, B., Valitutti, S., Bron, C., Tschopp, J., and Thome, M. (2002) CARMA1 is a Critical Lipid Raft-Associated Regulator of TCR-Induced NF-Kappa B Activation. Nat Immunol. 3, 836-843.
26. Che, T., You, Y., Wang, D., Tanner, M. J., Dixit, V. M., and Lin, X. (2004) MALT1/paracaspase is a Signaling Component Downstream of CARMA1 and Mediates T Cell Receptor-Induced NF-kappaB Activation. J Biol Chem. 279, 15870-15876.
27. Wang, D., You, Y., Case, S. M., McAllister-Lucas, L. M., Wang, L., DiStefano, P. S., Nunez, G., Bertin, J., and Lin, X. (2002) A Requirement for CARMA1 in TCR-Induced NF-Kappa B Activation. Nat Immunol. 3, 830-835.
28. Zhou, H., Wertz, I., O'Rourke, K., Ultsch, M., Seshagiri, S., Eby, M., Xiao, W., and Dixit, V. M. (2004) Bcl10 Activates the NF-kappaB Pathway through Ubiquitination of NEMO. Nature. 427, 167-171.
29. Sebban-Benin, H., Pescatore, A., Fusco, F., Pascuale, V., Gautheron, J., Yamaoka, S., Moncla, A., Ursini, M. V., and Courtois, G. (2007) Identification of TRAF6-Dependent NEMO Polyubiquitination Sites through Analysis of a New NEMO Mutation Causing Incontinentia Pigmenti. Hum Mol Genet. 16, 2805-2815.
30. Abbott, D. W., Wilkins, A., Asara, J. M., and Cantley, L. C. (2004) The Crohn's Disease Protein, NOD2, Requires RIP2 in Order to Induce Ubiquitinylation of a Novel Site on NEMO. Curr Biol. 14, 2217-2227.
31. Stilo, R., Liguoro, D., Di Jeso, B., Formisano, S., Consiglio, E., Leonardi, A., and Vito, P. (2004) Physical and Functional Interaction of CARMA1 and CARMA3 with Ikappa Kinase Gamma-NFkappaB Essential Modulator. J Biol Chem. 279, 34323-34331.
32. Kovalenko, A., Chable-Bessia, C., Cantarella, G., Israel, A., Wallach, D., and Courtois, G. (2003) The Tumour Suppressor CYLD Negatively Regulates NF-kappaB Signalling by Deubiquitination. Nature. 424, 801-805.
33. Mauro, C., Pacifico, F., Lavorgna, A., Mellone, S., Iannetti, A., Acquaviva, R., Formisano, S., Vito, P., and Leonardi, A. (2006) ABIN-1 Binds to NEMO/IKKgamma and Co-Operates with A20 in Inhibiting NF-kappaB. J Biol Chem. 281, 18482-18488.
34. Park, J. M., Greten, F. R., Wong, A., Westrick, R. J., Arthur, J. S., Otsu, K., Hoffmann, A., Montminy, M., and Karin, M. (2005) Signaling Pathways and Genes that Inhibit Pathogen-Induced Macrophage Apoptosis--CREB and NF-kappaB as Key Regulators. Immunity. 23, 319-329.
35. Ruocco, M. G., Maeda, S., Park, J. M., Lawrence, T., Hsu, L. C., Cao, Y., Schett, G., Wagner, E. F., and Karin, M. (2005) I{Kappa}B Kinase (IKK){Beta}, but Not IKK{Alpha}, is a Critical Mediator of Osteoclast Survival and is Required for Inflammation-Induced Bone Loss. J Exp Med. 201, 1677-1687.
36. Chen, L. W., Egan, L., Li, Z. W., Greten, F. R., Kagnoff, M. F., and Karin, M. (2003) The Two Faces of IKK and NF-kappaB Inhibition: Prevention of Systemic Inflammation but Increased Local Injury Following Intestinal Ischemia-Reperfusion. Nat Med. 9, 575-581.
37. Herrmann, O., Baumann, B., de Lorenzi, R., Muhammad, S., Zhang, W., Kleesiek, J., Malfertheiner, M., Kohrmann, M., Potrovita, I., Maegele, I., Beyer, C., Burke, J. R., Hasan, M. T., Bujard, H., Wirth, T., Pasparakis, M., and Schwaninger, M. (2005) IKK Mediates Ischemia-Induced Neuronal Death. Nat Med. 11, 1322-1329.
38. Lawrence, T., Bebien, M., Liu, G. Y., Nizet, V., and Karin, M. (2005) IKKalpha Limits Macrophage NF-kappaB Activation and Contributes to the Resolution of Inflammation. Nature. 434, 1138-1143.
39. Arkan, M. C., Hevener, A. L., Greten, F. R., Maeda, S., Li, Z. W., Long, J. M., Wynshaw-Boris, A., Poli, G., Olefsky, J., and Karin, M. (2005) IKK-Beta Links Inflammation to Obesity-Induced Insulin Resistance. Nat Med. 11, 191-198.
41. Lamberti, C., Lin, K. M., Yamamoto, Y., Verma, U., Verma, I. M., Byers, S., and Gaynor, R. B. (2001) Regulation of Beta-Catenin Function by the IkappaB Kinases. J Biol Chem. 276, 42276-42286.
42. Yan, J., Xiang, J., Lin, Y., Ma, J., Zhang, J., Zhang, H., Sun, J., Danial, N. N., Liu, J., and Lin, A. (2013) Inactivation of BAD by IKK Inhibits TNFalpha-Induced Apoptosis Independently of NF-kappaB Activation. Cell. 152, 304-315.
43. Jia, C. H., Li, M., Liu, J., Zhao, L., Lin, J., Lai, P. L., Zhou, X., Zhang, Y., Chen, Z. G., Li, H. Y., Liu, A. L., Yang, C. L., Gao, T. M., Jiang, Y., and Bai, X. C. (2013) IKK-Beta Mediates Hydrogen Peroxide Induced Cell Death through p85 S6K1. Cell Death Differ. 20, 248-258.
44. Comb, W. C., Hutti, J. E., Cogswell, P., Cantley, L. C., and Baldwin, A. S. (2012) P85alpha SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation. Mol Cell. 45, 719-730.
45. Lee, D. F., Kuo, H. P., Chen, C. T., Hsu, J. M., Chou, C. K., Wei, Y., Sun, H. L., Li, L. Y., Ping, B., Huang, W. C., He, X., Hung, J. Y., Lai, C. C., Ding, Q., Su, J. L., Yang, J. Y., Sahin, A. A., Hortobagyi, G. N., Tsai, F. J., Tsai, C. H., and Hung, M. C. (2007) IKK Beta Suppression of TSC1 Links Inflammation and Tumor Angiogenesis Via the mTOR Pathway. Cell. 130, 440-455.
46. Xia, Y., Padre, R. C., De Mendoza, T. H., Bottero, V., Tergaonkar, V. B., and Verma, I. M. (2009) Phosphorylation of p53 by IkappaB Kinase 2 Promotes its Degradation by Beta-TrCP. Proc Natl Acad Sci U S A. 106, 2629-2634.
47. Zandi, E., Rothwarf, D. M., Delhase, M., Hayakawa, M., and Karin, M. (1997) The IkappaB Kinase Complex (IKK) Contains Two Kinase Subunits, IKKalpha and IKKbeta, Necessary for IkappaB Phosphorylation and NF-kappaB Activation. Cell. 91, 243-252.
50. Hu, M. C., Lee, D. F., Xia, W., Golfman, L. S., Ou-Yang, F., Yang, J. Y., Zou, Y., Bao, S., Hanada, N., Saso, H., Kobayashi, R., and Hung, M. C. (2004) IkappaB Kinase Promotes Tumorigenesis through Inhibition of Forkhead FOXO3a. Cell. 117, 225-237.
51. Irelan, J. T., Murphy, T. J., DeJesus, P. D., Teo, H., Xu, D., Gomez-Ferreria, M. A., Zhou, Y., Miraglia, L. J., Rines, D. R., Verma, I. M., Sharp, D. J., Tergaonkar, V., and Chanda, S. K. (2007) A Role for IkappaB Kinase 2 in Bipolar Spindle Assembly. Proc Natl Acad Sci U S A. 104, 16940-16945.
53. Wu, R. C., Qin, J., Hashimoto, Y., Wong, J., Xu, J., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (2002) Regulation of SRC-3 (pCIP/ACTR/AIB-1/RAC-3/TRAM-1) Coactivator Activity by I Kappa B Kinase. Mol Cell Biol. 22, 3549-3561.
55. Wegener, E., Oeckinghaus, A., Papadopoulou, N., Lavitas, L., Schmidt-Supprian, M., Ferch, U., Mak, T. W., Ruland, J., Heissmeyer, V., and Krappmann, D. (2006) Essential Role for IkappaB Kinase Beta in Remodeling Carma1-Bcl10-Malt1 Complexes upon T Cell Activation. Mol Cell. 23, 13-23.
56. Lee, S., Andrieu, C., Saltel, F., Destaing, O., Auclair, J., Pouchkine, V., Michelon, J., Salaun, B., Kobayashi, R., Jurdic, P., Kieff, E. D., and Sylla, B. S. (2004) IkappaB Kinase Beta Phosphorylates Dok1 Serines in Response to TNF, IL-1, Or Gamma Radiation. Proc Natl Acad Sci U S A. 101, 17416-17421.
57. Gao, Z., Hwang, D., Bataille, F., Lefevre, M., York, D., Quon, M. J., and Ye, J. (2002) Serine Phosphorylation of Insulin Receptor Substrate 1 by Inhibitor Kappa B Kinase Complex. J Biol Chem. 277, 48115-48121.
59. Nielsen, C., Jakobsen, M. A., Larsen, M. J., Muller, A. C., Hansen, S., Lillevang, S. T., Fisker, N., and Barington, T. (2014) Immunodeficiency Associated with a Nonsense Mutation of IKBKB. J Clin Immunol. 34, 916-921.
60. Pannicke, U., Baumann, B., Fuchs, S., Henneke, P., Rensing-Ehl, A., Rizzi, M., Janda, A., Hese, K., Schlesier, M., Holzmann, K., Borte, S., Laux, C., Rump, E. M., Rosenberg, A., Zelinski, T., Schrezenmeier, H., Wirth, T., Ehl, S., Schroeder, M. L., and Schwarz, K. (2013) Deficiency of Innate and Acquired Immunity Caused by an IKBKB Mutation. N Engl J Med. 369, 2504-2514.
61. Li, Q., Van Antwerp, D., Mercurio, F., Lee, K. F., and Verma, I. M. (1999) Severe Liver Degeneration in Mice Lacking the IkappaB Kinase 2 Gene. Science. 284, 321-325.
62. Tanaka, M., Fuentes, M. E., Yamaguchi, K., Durnin, M. H., Dalrymple, S. A., Hardy, K. L., and Goeddel, D. V. (1999) Embryonic Lethality, Liver Degeneration, and Impaired NF-Kappa B Activation in IKK-Beta-Deficient Mice. Immunity. 10, 421-429.
64. Kaisho, T., Takeda, K., Tsujimura, T., Kawai, T., Nomura, F., Terada, N., and Akira, S. (2001) IkappaB Kinase Alpha is Essential for Mature B Cell Development and Function. J Exp Med. 193, 417-426.
65. Yamada, T., Mitani, T., Yorita, K., Uchida, D., Matsushima, A., Iwamasa, K., Fujita, S., and Matsumoto, M. (2000) Abnormal Immune Function of Hemopoietic Cells from Alymphoplasia (Aly) Mice, a Natural Strain with Mutant NF-Kappa B-Inducing Kinase. J Immunol. 165, 804-812.
66. Li, Z. W., Omori, S. A., Labuda, T., Karin, M., and Rickert, R. C. (2003) IKK Beta is Required for Peripheral B Cell Survival and Proliferation. J Immunol. 170, 4630-4637.
67. Schmidt-Supprian, M., Courtois, G., Tian, J., Coyle, A. J., Israel, A., Rajewsky, K., and Pasparakis, M. (2003) Mature T Cells Depend on Signaling through the IKK Complex. Immunity. 19, 377-389.
68. Schmidt-Supprian, M., Tian, J., Grant, E. P., Pasparakis, M., Maehr, R., Ovaa, H., Ploegh, H. L., Coyle, A. J., and Rajewsky, K. (2004) Differential Dependence of CD4+CD25+ Regulatory and Natural Killer-Like T Cells on Signals Leading to NF-kappaB Activation. Proc Natl Acad Sci U S A. 101, 4566-4571.
69. Nenci, A., Becker, C., Wullaert, A., Gareus, R., van, L. G., Danese, S., Huth, M., Nikolaev, A., Neufert, C., Madison, B., Gumucio, D., Neurath, M. F., and Pasparakis, M. (2007) Epithelial NEMO Links Innate Immunity to Chronic Intestinal Inflammation. Nature. 446, 557-561.
70. Pasparakis, M., Courtois, G., Hafner, M., Schmidt-Supprian, M., Nenci, A., Toksoy, A., Krampert, M., Goebeler, M., Gillitzer, R., Israel, A., Krieg, T., Rajewsky, K., and Haase, I. (2002) TNF-Mediated Inflammatory Skin Disease in Mice with Epidermis-Specific Deletion of IKK2. Nature. 417, 861-866.
71. Mourkioti, F., Kratsios, P., Luedde, T., Song, Y. H., Delafontaine, P., Adami, R., Parente, V., Bottinelli, R., Pasparakis, M., and Rosenthal, N. (2006) Targeted Ablation of IKK2 Improves Skeletal Muscle Strength, Maintains Mass, and Promotes Regeneration. J Clin Invest. 116, 2945-2954.
72. Perez-Nazario, N., Rangel-Moreno, J., O'Reilly, M. A., Pasparakis, M., Gigliotti, F., and Wright, T. W. (2013) Selective Ablation of Lung Epithelial IKK2 Impairs Pulmonary Th17 Responses and Delays the Clearance of Pneumocystis. J Immunol. 191, 4720-4730.
73. Dominguez, J. A., Samocha, A. J., Liang, Z., Burd, E. M., Farris, A. B., and Coopersmith, C. M. (2013) Inhibition of IKKbeta in Enterocytes Exacerbates Sepsis-Induced Intestinal Injury and Worsens Mortality. Crit Care Med. 41, e275-85.
74. van, L. G., De, L. R., Schmidt, H., Huth, M., Mildner, A., Schmidt-Supprian, M., Lassmann, H., Prinz, M. R., and Pasparakis, M. (2006) Inhibition of Transcription Factor NF-kappaB in the Central Nervous System Ameliorates Autoimmune Encephalomyelitis in Mice. Nat Immunol. 7, 954-961.
75. Peschke, K., Weitzmann, A., Heger, K., Behrendt, R., Schubert, N., Scholten, J., Voehringer, D., Hartmann, K., Dudeck, A., Schmidt-Supprian, M., and Roers, A. (2014) IkappaB Kinase 2 is Essential for IgE-Induced Mast Cell De Novo Cytokine Production but Not for Degranulation. Cell Rep. 8, 1300-1307.
|
Science Writers | Anne Murray |
Illustrators | Peter Jurek |
Authors | Jeff SoRelle, Takuma Misawa, Duanwu Zhang, Tao Yue, Zhe Chen, and Bruce Beutler |