Phenotypic Mutation 'mask'

• Allele: mask
• Mutation Type: intron (2 bp from exon)
• Chromosome: 15
• Coordinate: 78,464,455 bp (GRCm38)
• Base Change: T ⇒ C (forward strand)
• Gene: Tmprss6
• Gene Name: transmembrane serine protease 6
• Synonym(s): matriptase-2, 1300008A22Rik
• Chromosomal Location: 78,323,867-78,352,834 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] ; PHENOTYPE: Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9DBI0
• SMART Domains: Protein: ENSMUSP00000017086; Gene: ENSMUSG00000016942

Domain	Start	End	E-Value	Type
low complexity region	19	39	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC
Pfam:SEA	88	191	3.2e-13	PFAM
CUB	341	452	3.82e-2	SMART
LDLa	457	489	1.33e-2	SMART
LDLa	490	527	2.31e-9	SMART
LDLa	530	568	1.07e-4	SMART
Tryp_SPc	576	806	3.75e-97	SMART

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.074)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos
• MMRRC Submission: 016987-UCD
• Last Updated: 2018-03-06 10:32 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2008-03-31
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Xin Du, Bruce Beutler

Accession Number

NCBI RefSeq: NM_027902; MGI: 1919003

Alleles Listed at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1) Chemically induced(3)  

Phenotypic Description

The mask mutant phenotype emerged as a visible variant among G3 mice homozygous for mutations induced by ENU (1). Mask mice initially grow a normal, full coat of hair by postnatal day 10 (P10), but then gradually lose hair from the trunk beginning at P13 until they are nude by P28 (Figure 1). Hair loss is heterogeneous among mask animals, with some retaining sparse hair and others being completely nude. However, facial hair is preserved in all mask mutants. Mask homozygotes are slightly smaller than their heterozygous littermates, and adult homozygous females are infertile.

 

Mask mice exhibit no immunological deficiencies, but hematological tests reveal microcytic anemia, as measured by decreased mean cell volume (MCV) of red blood cells (RBCs) and decreased hemoglobin. When maintained on a standard laboratory diet, mask mice have low serum iron concentration and low tissue iron stores. Benzidine staining of mask mouse feces indicates that they do not lose iron through enteric blood. Intestinal iron absorption, measured by the retention of ⁵⁹Fe after intragastric administration, is normal or slightly increased in mask homozygotes compared to wild type mice fed a standard diet. However, when wild type and mask mice are maintained on an iron-deficient diet for two weeks, the iron-deprived but non-anemic wild type mice show about a 6-fold increase in efficiency of ⁵⁹Fe absorption, while anemic mask homozygotes show only a 3.5-fold increase in comparison to animals maintained on a standard laboratory diet. In addition, iron-deprived mask homozygotes have approximately 8-fold higher levels of hepcidin-encoding mRNA compared to iron-deprived control mice. Hair growth, fertility and serum iron levels are restored when mask mice are fed a high-iron diet (Figure 2) or administered iron intraperitoneally.

Nature of Mutation

The mask mutation was mapped to Chromosome 15, and corresponds to an A to G transition in the acceptor splice site of intron 14 (TATCAG -> TATCGG) of the Tmprss6 gene on Chromosome 15 (position 24788 in Genbank genomic region NC_000081 for linear genomic DNA sequence of Tmprss6). Tmprss6 contains 18 exons.

 

The mutation destroys the intron 14 acceptor splice site. No normal transcripts are detected in homozygous mask mice; cDNA sequencing demonstrates two abnormal splice products that would encode proteins lacking the proteolytic domain. One results from the use of a cryptic acceptor splice site within exon 15, and this product lacks 14 nucleotides of the 5’ sequence of exon 15 encoding 5 amino acids. The mutation destroys the reading frame after amino acid 566 and creates a premature stop codon that would truncate the protein after amino acid 581. In the following diagram, the acceptor splice site of intron 14 is indicated in blue lettering; the mutated nucleotide is indicated in red lettering; the new splice site is highlighted in gray:

 

      <--exon 14  <--intron 14 exon 15-->

24530 CAACACTGTG……………CATTATCAG ACTGTGGCCTCCAG GGCCTCTCCAGCCGTATTGTGGGCGGGACCGTGTCCTCCGAGGGTGA 24850

564   -Q--H--C--               D--C--G--L--Q- G--P--L--Q--P--Y--C--G--R--D--R--V--L--R--G--*  581

       correct                   deleted                       aberrant

 

The other splice product results from use of the normal intron 15 acceptor splice site, and therefore skips exon 15 entirely. The mutation destroys the reading frame after amino acid 566 and creates a premature stop codon that truncates the protein after amino acid 594. In the following diagram, the acceptor splice site of intron 14 is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.

 

      <--exon 14  <--intron 14 exon 15-->    exon 16-->

24530 CAACACTGTG……………CATTATCAG ACTGTGGCC……………CATGGCCTCCCCGAAGCTGT…………………GCGAGGTGTCCTTCAAGGTGA 26167 

564   -Q--H--C--               D--C--G--     A--W--P--P--R--S--C-…………………-R--A--G--P--S--R--*  594     

       correct                  deleted                         aberrant

 

BAC transgenesis in homozygous mask mutants confirmed that the Tmprss6 mutation is responsible for the mask phenotype. Four of four transgenic animals showed rescue of the hair loss phenotype, and three of four transgenic animals showed rescue of anemia and iron deficiency.

Protein Prediction

Figure 3. Domain structure of TMPRSS6. The C terminus of the protein, including the serine protease domain, is extracellular. Predicted N-glycosylation  sites are noted in violet circles. The mask mutation corresponds to an A to G transition in the acceptor splice site of intron 14 of the TMPRSS6 protein. This image is interactive. Click on the image to view other mutations found in TMPRSS6 (red). Click on the mutations for more specific information.

Tmprss6 encodes an 811-amino acid protein of the type II transmembrane protease family (2). TMPRSS6, also known as matriptase-2, is predicted to contain a C-terminal trypsin-like serine protease domain (shown to be extracellular), three class A LDL receptor domains, two CUB domains (similar to a domain represented in BMP1 as well as C1R and C1S proteins), and a membrane-proximal SEA domain (Figure 3) (1;3). TMPRSS6 contains seven predicted N-glycosylation sites (3). The mask mutation eliminates the intron 14 acceptor splice site and results in the expression of two aberrant transcripts; the encoded proteins are truncated after amino acids 581 or 594, deleting approximately 90% of the serine protease domain. Mutant TMPRSS6 was demonstrated to lack proteolytic activity (see Putative Mechanism).

Expression/Localization

An expression anatomy database indicates that Tmprss6 expression is limited to the liver, olfactory epithelium and vomeronasal epithelium (http://symatlas.gnf.org/SymAtlas/). In both humans and mice, the major site of Tmprss6 expression is the liver. RT-PCR and Northern blot analysis of human and mouse tissues confirm these data (3;4). Expression of Tmprss6 mRNA has also been reported in human thyroid and trachea (2), and in mouse kidney and uterus (3). TMPRSS6 localizes to the cell membrane (3;4) with the serine protease domain projecting into the extracellular space.

Background

Figure 4. (A) Iron is absorbed by duodenal enterocytes, oxidized from the ferrous to the ferric state, and exported into the plasma by the iron export channel ferroportin. Iron recycled from senescent red blood cells by macrophages is also exported to the plasma by ferroportin. Tissues take up plasma iron when it is bound to transferrin, and excess iron in the plasma (which exceeds the binding capacity of transferrin) is deposited in the liver for storage. The peptide hormone hepcidin, encoded by Hamp , negatively regulates intestinal iron absorption until iron stores need to be resupplied. Hepcidin also regulates plasma iron levels by binding to ferroportin and triggering ferroportin internalization and degradation in both enterocytes and macrophages, thereby lowering plasma iron levels. (B) Hepcidin expression is induced under conditions of elevated iron. Binding of Tf-Fe(3+) to TFR2 results in recruitment of HFE, HJV, and the BMP receptor. BMP binding to the receptor complex activates the SMAD pathway leading to Hamp transcription. Low plasma iron leads to HJV cleavage by furin, producing soluble HJV (sHJV), which binds to BMP and blocks activation of the BMP receptor. TMPRSS6 negatively regulates Hamp transcription, possibly by cleaving HJV; the mechanism is not yet known.

Organisms must both provide for the cellular requirements for iron and avoid toxicity associated with excessive iron. There is no active, regulated mechanism for excreting excess iron from the body, and iron levels must therefore be regulated at the level of absorption, which occurs in the small intestine. The liver plays a central role in regulating intestinal iron absorption, and serves as one of the main depots for iron storage in the body. The movement of iron from intestinal enterocytes into the bloodstream is mediated by the iron export channel ferroportin (5;6) with the aid of hephaestin, which oxidizes ferrous iron to the ferric state (7). Once in the plasma, the protein transferrin binds to iron and mediates its transfer into cells via transferrin receptors.

 

Recently, the peptide hormone hepcidin was identified as the major systemic iron regulator (8;9). Hepcidin is expressed in and secreted into circulation from the liver (Figure 4). Hepcidin binds to ferroportin and causes internalization and proteolysis of the channel, preventing release of iron from intestinal cells into the plasma (10). In this manner, hepcidin lowers plasma iron levels, and chronic elevation of hepcidin levels causes systemic iron deficiency (11). Conversely, hepcidin deficiency causes iron overload (12).

 

Current understanding of the regulation of hepcidin levels involves the action of three main proteins, HFE (13), transferrin receptor 2 (TfR2; see the record for iron-man) (14), and hemojuvelin (HJV) (15), which promote expression of the gene encoding hepcidin (Hamp). Hemojuvelin contains a glycophosphatidylinositol anchor, and exists in both membrane-associated and soluble forms (16). In cells transfected to express hemojuvelin, iron loading reduces soluble hemojuvelin release into the culture medium. Conversely, in iron-deprived rats low serum iron levels result in elevated serum HJV levels (17). These findings are consistent with a role for soluble hemojuvelin in suppressing Hamp expression. It was proposed that membrane-associated hemojuvelin binds to a cell surface receptor to stimulate Hamp expression, an interaction competitively inhibited by receptor binding to soluble hemojuvelin (16;18). More recently, HFE and TfR2 were reported to associate with hemojuvelin in a stable cell surface complex that serves as a receptor for bone morphogenetic proteins (BMPs), which have been shown to upregulate Hamp (19-22). Hamp expression is also positively regulated by the transcription factor SMAD4, through epigenetic modification of histone H3 to a transcriptionally active form (23).

 

Human patients or mice with mutant forms of HFE, TfR2 or hemojuvelin exhibit hemochromatosis, a disease characterized by increased iron absorption and increased serum iron levels despite high body iron stores, and inappropriately low levels of hepcidin. Although mutations in HFE and TfR2 contribute to hemochromatosis (OMIM +235200, #604250), mutations in HJV lead to a much more severe iron loading phenotype observed in the rarer juvenile hemochromatosis condition (OMIM #602390) (15). Patients with mutations in both HFE and TfR2 are phenotypically similar to patients with a HJV mutation alone (24). Juvenile hemochromatosis patients have undetectable levels of hepcidin, suggesting that HJV is essential for hepcidin expression (15). Mutations in several other iron metabolism proteins, including ceruloplasmin, divalent metal transporter 1 [DMT/ Nramp2 (natural resistance-associated macrophage protein 2)], ferritin, ferroportin, HFE, hephaestin, transferrin, and the two transferrin receptors, also cause either hemochromatosis or anemia in both humans and mice (25).

 

Matriptase-1 and Tmprss6 share a similar domain structure, and 35% identical gene sequences (4). Matriptase-1 is proposed to play a role in the progression of several types of cancer. A targeted knockout of matriptase in mice causes death within 48 hours of birth with dry, red, shiny, and wrinkled skin appearance, possibly due to dehydration (26). Matriptase-deficient mice are reported to display increased thymocyte apoptosis (26), but no hematological analysis has been performed on these mice.

Putative Mechanism

Low iron levels coupled with high Hamp transcript levels in mask homozygotes suggested that TMPRSS6 is a non-redundant component in a pathway that senses iron deficiency and negatively regulates Hamp expression to promote iron uptake (1). This was tested by overexpression of TMPRSS6 or the mask mutant version of TMPRSS6 together with Hamp-activating stimuli in the HepG2 liver cell line (1). Cotransfected hemojuvelin- or SMAD1-encoding sequences, or stimulation with interleukin (IL)-1a, IL-6, BMP2, BMP4, or BMP9, known positive Hamp regulators, were used to induce the Hamp promoter. TMPRSS6 cotransfection strongly inhibited Hamp reporter gene activation by each stimulus while the mask mutant version of TMPRSS6 showed at most a modest inhibitory effect. SMAD1-induced Hamp promoter responses were also blocked by normal but not truncated TMPRSS6.

 

TMPRSS6 proteolytic activity is critical for its Hamp-suppressing activity, as a protease dead point mutant of TMPRSS6 fails to block Hamp expression induced by IL-6 and BMP2 and BMP9 (1). Interestingly, both a C-terminal TMPRSS6 truncation mutant containing the transmembrane and cytoplasmic domains, and an N-terminal truncation mutant containing the transmembrane domain and ectodomain, suppress Hamp expression more strongly than wild type TMPRSS6 (1). Thus, the TMPRSS6 ectodomain normally represses a signal for Hamp suppression, since deletion of the ectodomain results in greater Hamp inhibition compared to inhibition by wild type TMPRSS6. Signal transduction by the cytoplasmic domain of TMPRSS6 must also be integral to Hamp inhibition, since it autonomously drives a Hamp suppression signal. Furthermore, the ability of the TMPRSS6 N-terminal truncation mutant (containing only the transmembrane domain and ectodomain) to inhibit Hamp expression when overexpressed may indicate that (potentially ligand-mediated) oligomerization of TMPRSS6 may activate the Hamp suppression pathway. Intact proteolytic activity is required for this function. It appears unlikely that TMPRSS6 serves as a major factor in cleaving and releasing soluble hemojuvelin from the cell surface, since a hemojuvelin-cleaving enzyme has already been identified (27;28).

 

Further study will be required to fully understand the mechanisms by which TMPRSS6 mediates Hamp inhibition and promotes iron uptake. However, using a series of Hamp promoter deletion constructs, TMPRSS6-mediated inhibition of Hamp expression was shown to require a minimum of 140 bp of Hamp promoter sequence upstream from the 5’ cap, while the full activating effect of IL-6 required 260 bp of promoter sequence (1). Whether repressive elements exist 5’ to the first 140 bp of promoter sequence as well remains unknown. Preliminary work has also shown that a rather small number of genes seem to be modulated in response to overexpression of TMPRSS6 in HepG2 cells (GEO Accession GSE10591).

 

In vitro,TMPRSS6 can proteolyze several recombinant extracellular matrix (ECM) proteins including fibronectin, laminin and type I collagen (4). Its substrate specificity against synthetic peptides is similar to that of matriptase, with Gln-Gly-Arg and Gln-Ala-Arg being their preferred substrates, respectively (4). However, a physiological function for ECM cleavage by TMPRSS6 has not been demonstrated. On the contrary, it appears that the principal function of TMPRSS6 is in sensing low iron levels and suppressing Hamp. Importantly, the TMPRSS6 pathway regulates the absorption of iron when it is present in quantities supported by the standard laboratory mouse diet. Systemic iron deficiency can be overcome in mask homozygotes when they are fed with a diet that is very rich in iron, suggesting that the TMPRSS6->Hamp suppression axis can be circumvented, and that a hepcidin-insensitive pathway for iron absorption must exist.

 

Low iron sensing may also occur in the olfactory epithelium, since Tmprss6 is expressed there. It has been suggested that this may prompt iron-seeking behavior by changing olfactory signals to the brain (1).

 

The mechanism of hair loss in mask homozygotes remains to be established, although severe iron deficiency is associated with hair loss in humans (29) as in mice (30).

Primers

Primers cannot be located by automatic search.

Genotyping

Mask genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

 

Primers

Mask(F): 5’- CTCGTTGCTCAGAGACCCACCTTCAG -3’

Mask(R): 5’- ATCTCCCACGGTCCTTCCCTATGCC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 60°C             0:20

4) 72°C             1:00

5) repeat steps (2-4) 34X

6) 72°C             5:00

7) 4°C              ∞

 

The following sequence of 643 nucleotides (from Genbank genomic region NC_000081 for linear genomic sequence of Tmprss6) is amplified.

 

24370          c tcgttgctca gagacccacc ttcagtggcc tgctcggtcc cctccatccc

24421 aggagtgccc tgtgggacat tcactttcca gtgtgaggac cggagctgtg tgaagaagcc

24481 caacccagag tgtgacggcc agtcagattg cagagacggc tcagatgagc aacactgtgg

24541 tgagcctgtt agccagggct gtgcatgaag gccaggcctg ggagtggggc atggactctc

24601 atgggaagca ggaggggagt gtcaccatgt gtctgttccg tgcctagctg tctctgtcac

24661 ctgttcctgg gcctagctct cctttccccc cacacctctt cattgcttta ctttgttgtc

24721 tgtctccatt tctcacgagc ctttcttcct cccctctcct tcttctctgt ccccccccac

24781 cattatcaga ctgtggcctc cagggcctct ccagccgtat tgtgggcggg accgtgtcct

24841 ccgagggtga gtggccatgg caggccagcc tccagattcg gggtcgacac atctgtgggg

24901 gggctctcat cgctgaccgc tgggtcataa cggccgccca ctgcttccag gaggacaggt

24961 gaggggacac cacagggcct ggggatgggc atagggaagg accgtgggag at

 

Primer binding sites are underlined; the mutated A is highlighted in red.

References

   1.  Du, X., She, E., Gelbart, T., Truska, J., Lee, P., Xia, Y., Khovananth, K., Mudd, S., Mann, N., Moresco, E. M. Y., Beutler, E., and Beutler, B. (2008) The serine protease TMPRSS6 is required to sense iron deficiency, Science, 320, 1088-1092.

   2.  Park, T. J., Lee, Y. J., Kim, H. J., Park, H. G., and Park, W. J. (2005) Cloning and characterization of TMPRSS6, a novel type 2 transmembrane serine protease, Mol. Cells 19, 223-227.

   3.  Hooper, J. D., Campagnolo, L., Goodarzi, G., Truong, T. N., Stuhlmann, H., and Quigley, J. P. (2003) Mouse matriptase-2: identification, characterization and comparative mRNA expression analysis with mouse hepsin in adult and embryonic tissues, Biochem. J. 373, 689-702.

   4.  Velasco, G., Cal, S., Quesada, V., Sanchez, L. M., and Lopez-Otin, C. (2002) Matriptase-2, a membrane-bound mosaic serine proteinase predominantly expressed in human liver and showing degrading activity against extracellular matrix proteins, J. Biol. Chem. 277, 37637-37646.

   5.  Donovan, A., Brownlie, A., Zhou, Y., Shepard, J., Pratt, S. J., Moynihan, J., Paw, B. H., Drejer, A., Barut, B., Zapata, A., Law, T. C., Brugnara, C., Lux, S. E., Pinkus, G. S., Pinkus, J. L., Kingsley, P. D., Palis, J., Fleming, M. D., Andrews, N. C., and Zon, L. I. (2000) Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter, Nature 403, 776-781.

   6.  Fraenkel, P. G., Traver, D., Donovan, A., Zahrieh, D., and Zon, L. I. (2005) Ferroportin1 is required for normal iron cycling in zebrafish, J. Clin. Invest 115, 1532-1541.

   7.  Anderson, G. J. and Frazer, D. M. (2005) Recent advances in intestinal iron transport, Curr. Gastroenterol. Rep. 7, 365-372.

   8.  Deicher, R. and Horl, W. H. (2006) New insights into the regulation of iron homeostasis, Eur. J. Clin. Invest 36, 301-309.

   9.  Ganz, T. (2004) Hepcidin in iron metabolism, Curr. Opin. Hematol. 11, 251-254.

   10.  Nemeth, E., Tuttle, M. S., Powelson, J., Vaughn, M. B., Donovan, A., Ward, D. M., Ganz, T., and Kaplan, J. (2004) Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization, Science 306, 2090-2093.

   11.  Nicolas, G., Bennoun, M., Porteu, A., Mativet, S., Beaumont, C., Grandchamp, B., Sirito, M., Sawadogo, M., Kahn, A., and Vaulont, S. (2002) Severe iron deficiency anemia in transgenic mice expressing liver hepcidin, Proc. Natl. Acad. Sci. U. S. A 99, 4596-4601.

   12.  Nemeth, E. and Ganz, T. (2006) Regulation of iron metabolism by hepcidin, Annu. Rev. Nutr. 26, 323-342.

   13.  Ahmad, K. A., Ahmann, J. R., Migas, M. C., Waheed, A., Britton, R. S., Bacon, B. R., Sly, W. S., and Fleming, R. E. (2002) Decreased liver hepcidin expression in the Hfe knockout mouse, Blood Cells Mol Dis. 29, 361-366.

   14.  Kawabata, H., Fleming, R. E., Gui, D., Moon, S. Y., Saitoh, T., O'Kelly, J., Umehara, Y., Wano, Y., Said, J. W., and Koeffler, H. P. (2005) Expression of hepcidin is down-regulated in TfR2 mutant mice manifesting a phenotype of hereditary hemochromatosis, Blood 105, 376-381.

   15.  Papanikolaou, G., Samuels, M. E., Ludwig, E. H., MacDonald, M. L., Franchini, P. L., Dube, M. P., Andres, L., MacFarlane, J., Sakellaropoulos, N., Politou, M., Nemeth, E., Thompson, J., Risler, J. K., Zaborowska, C., Babakaiff, R., Radomski, C. C., Pape, T. D., Davidas, O., Christakis, J., Brissot, P., Lockitch, G., Ganz, T., Hayden, M. R., and Goldberg, Y. P. (2004) Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis, Nat. Genet. 36, 77-82.

   16.  Lin, L., Goldberg, Y. P., and Ganz, T. (2005) Competitive regulation of hepcidin mRNA by soluble and cell-associated hemojuvelin, Blood 106, 2884-2889.

   17.  Zhang, A. S., Anderson, S. A., Meyers, K. R., Hernandez, C., Eisenstein, R. S., and Enns, C. A. (2007) Evidence that inhibition of hemojuvelin shedding in response to iron is mediated through neogenin, J. Biol. Chem. 282, 12547-12556.

   18.  Silvestri, L., Pagani, A., Fazi, C., Gerardi, G., Levi, S., Arosio, P., and Camaschella, C. (2007) Defective targeting of hemojuvelin to plasma membrane is a common pathogenetic mechanism in juvenile hemochromatosis, Blood 109, 4503-4510.

   19.  Babitt, J. L., Huang, F. W., Wrighting, D. M., Xia, Y., Sidis, Y., Samad, T. A., Campagna, J. A., Chung, R. T., Schneyer, A. L., Woolf, C. J., Andrews, N. C., and Lin, H. Y. (2006) Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression, Nat. Genet. 38, 531-539.

   20.  Truksa, J., Peng, H., Lee, P., and Beutler, E. (2006) Bone morphogenetic proteins 2, 4, and 9 stimulate murine hepcidin 1 expression independently of Hfe, transferrin receptor 2 (Tfr2), and IL-6, Proc. Natl. Acad. Sci. U. S. A 103, 10289-10293.

   21.  Babitt, J. L., Huang, F. W., Xia, Y., Sidis, Y., Andrews, N. C., and Lin, H. Y. (2007) Modulation of bone morphogenetic protein signaling in vivo regulates systemic iron balance, J. Clin. Invest 117, 1933-1939.

   22.  Lin, L., Valore, E. V., Nemeth, E., Goodnough, J. B., Gabayan, V., and Ganz, T. (2007) Iron-transferrin regulates hepcidin synthesis in primary hepatocyte culture through hemojuvelin and BMP2/4, Blood.

   23.  Wang, R. H., Li, C., Xu, X., Zheng, Y., Xiao, C., Zerfas, P., Cooperman, S., Eckhaus, M., Rouault, T., Mishra, L., and Deng, C. X. (2005) A role of SMAD4 in iron metabolism through the positive regulation of hepcidin expression, Cell Metab 2, 399-409.

   24.  Pietrangelo, A., Caleffi, A., Henrion, J., Ferrara, F., Corradini, E., Kulaksiz, H., Stremmel, W., Andreone, P., and Garuti, C. (2005) Juvenile hemochromatosis associated with pathogenic mutations of adult hemochromatosis genes, Gastroenterology 128, 470-479.

   25.  Andrews, N. C. (2000) Iron homeostasis: insights from genetics and animal models, Nat. Rev. Genet. 1, 208-217.

   26.  List, K., Haudenschild, C. C., Szabo, R., Chen, W., Wahl, S. M., Swaim, W., Engelholm, L. H., Behrendt, N., and Bugge, T. H. (2002) Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis, Oncogene 21, 3765-3779.

   27.  Lin, L., Nemeth, E., Goodnough, J. B., Thapa, D. R., Gabayan, V., and Ganz, T. (2008) Soluble hemojuvelin is released by proprotein convertase-mediated cleavage at a conserved polybasic RNRR site, Blood Cells Mol. Dis. 40, 122-131.

   28.  Silvestri, L., Pagani, A., and Camaschella, C. (2008) Furin-mediated release of soluble hemojuvelin: a new link between hypoxia and iron homeostasis, Blood 111, 924-931.

   29.  Deloche, C., Bastien, P., Chadoutaud, S., Galan, P., Bertrais, S., Hercberg, S., and de, L. O. (2007) Low iron stores: a risk factor for excessive hair loss in non-menopausal women, Eur. J. Dermatol. 17, 507-512.

   30.  Russell, E. S., McFarland, E. C., and Kent, E. L. (1970) Low viability, skin lesions, and reduced fertility associated with microcytic anemia in the mouse, Transplant. Proc. 2, 144-151.