Phenotypic Mutation 'hera' (pdf version)
Allelehera
Mutation Type missense
Chromosome9
Coordinate107,513,280 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Cacna2d2
Gene Name calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonym(s) a2d2
Chromosomal Location 107,399,612-107,529,343 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001174047 (variant 1), NM_020263 (variant 2), NM_001174048 (variant 3), NM_001174049 (variant 4), NM_001174050 (variant 5); MGI:1929813

Mapped Yes 
Amino Acid Change Valine changed to Alanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000010210] [ENSMUSP00000082173] [ENSMUSP00000130451] [ENSMUSP00000126029] [ENSMUSP00000132512] [ENSMUSP00000125943]
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000010210)
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000085092)
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
(Using ENSMUST00000164988)
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000166799)
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000168532)
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000170737)
Meta Mutation Damage Score 0.196 question?
Is this an essential gene? Probably essential (E-score: 0.829) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 17376154 19854154
Body Weight (Male) - decreased 17376154 19854154
growth/size
Candidate Explorer Status CE: potential candidate; human score: -0.5; ML prob: 0.256
Single pedigree
Linkage Analysis Data
Penetrance 3/3 
Alleles Listed at MGI

All mutations/alleles(10) : Chemically induced (ENU)(1) Gene trapped(2) Spontaneous(4) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0538:Cacna2d2 UTSW 9 107524383 splice site probably benign
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R0729:Cacna2d2 UTSW 9 107517257 missense probably benign 0.06
R1024:Cacna2d2 UTSW 9 107527050 critical splice donor site probably null
R1538:Cacna2d2 UTSW 9 107517416 missense probably damaging 1.00
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4021:Cacna2d2 UTSW 9 107514058 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R4629:Cacna2d2 UTSW 9 107527322 missense probably damaging 1.00
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5347:Cacna2d2 UTSW 9 107514114 missense probably benign
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, gDNA
MMRRC Submission 038213-MU
Last Updated 2017-09-13 4:26 PM by Diantha La Vine
Record Created 2015-06-16 1:19 PM by Jeff SoRelle
Record Posted 2015-08-24
Phenotypic Description

Figure 1. Hera mice exhibited diminished body weights compared to littermates. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hera phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2266, some of which exhibited reduced body weights compared to their littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 81 mutations (X-axis) identified in the G1 male of pedigree R2266. Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 81 mutations. The diminished body weight phenotype was linked to a mutation in Cacna2d2:  a T to C transversion at base pair 107,513,280 (v38) on chromosome 9, or base pair 113,401 in the GenBank genomic region NC_000075.  Linkage was found with a recessive model of inheritance (P = 3.048 x 10-8), wherein 3 variant homozygotes departed phenotypically from 16 homozygous reference mice and 15 heterozygous mice (Figure 2).  

 

The mutation corresponds to residue 1,139 in the mRNA sequence NM_001174047 within exon 10 of 39 total exons.

 

113385 CTGATGAAGACGTCCGTCTGTGAGATGCTAGAC

312    -L--M--K--T--S--V--C--E--M--L--D-

 

Genomic numbering corresponds to NC_000075. The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to alanine (A) substitution at position 317 (V317A) in all of the α2δ2 (Cacna2d2) protein variants, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.886) (1).

Protein Prediction
Figure 3. The voltage-dependent calcium (Ca2+) channel (VDCC) subunits.

Cacna2d2 encodes α2δ2, a subunit of the voltage-dependent calcium (Ca2+) channel (VDCC). The VDCC is a heterooligomer composed of a pore-forming α1 subunit, an intracellular β subunit, a membrane-spanning γ subunit, and a membrane-anchored α2δ subunit (Figure 3). The VDCCs are divided into three families, each containing different α1 subunits: the high voltage-activated L-type (Cav1) family (α1S, α1C, α1D, and α1F); the non-L-type high voltage-activated (Cav2) family, including the P/Q/O-type (α1A), the N-type (α1B), and the R-type (α1E); and the low voltage-activated T-type (Cav3) family (α1G, α1H, and α1I) (Table 1). The β subunit has four family members (β1-β4) encoded by four distinct genes. The Cav1 and Cav2 Ca2 + channels require the auxiliary β subunit to increase α1 expression at the plasma membrane as well as to modulate the biophysical properties of the channel current. The γ subunit has eight members (γ1-γ8) encoded by different genes. The γ subunits are proposed to regulate channel inactivation (2). The α2δ2 subunit is one of four α2δ subunit isoforms (α2δ1–α2δ4) encoded by different genes.

 

Table 1. Summary of the types of VDCCs

 

Channel type

Localization

Function

References

High voltage-activated

L-type

Expressed in all excitable cells as well as several types of non-excitable cells

Primary route for Ca2+ entry into cardiac, skeletal, and smooth muscles (excitation-contraction coupling); visual transduction; endocrine secretion

(3)

P/Q/O-type

Purkinje cells (P-type)

Neurotransmitter release; Ca2+-dependent action potentials in the dendrites of cerebellar Purkinje cells

(4;5)

N-type

Only expressed in neural tissues including dorsal root ganglion cells, sympathetic neurons, other cells of the peripheral and central nervous systems; presynaptic terminals

Neurotransmitter release; integration or amplification of neural inputs; nervous system development; Ca2+-dependent action potentials in the dendrites of cerebellar Purkinje cells

(6)

R-type

Cerebellar granule cells

Neurotransmitter release; Ca2+-dependent action potentials in the dendrites of cerebellar Purkinje cells

(5)

Low voltage-activated

T-type

Cardiac and smooth muscle; several neuronal cells in the central nervous system

Pace-making activity of the SA Node within the heart and relay rapid action potentials within the thalamus

(7)

 

Figure 4. Domain organization of the α2δ2 subunit of the voltage-dependent calcium (Ca2+) channel. The location of the hera mutation is marked. The α2δ subunits are posttranslationally cleaved into an N-terminal α2 peptide (designated by a green dotted line) and a membrane-anchored δ peptide (designated by a red dotted line). Abbreviations: SP, signal peptide; MIDAS, metal ion-dependent adhesion site; VWFA, von Willebrand factor A domain; Cache, calcium channels and chemotaxis receptors.

The α2δ subunits share similar domains and topology. The α2δ2 subunit has an extracellular N-terminus (amino acids 19-1116), a single transmembrane domain (amino acids 1117-1137), and a cytoplasmic C-terminus (amino acids 1138-1154) (Figure 4). After translation, the α2δ subunits are cleaved into an N-terminal α2 peptide and a membrane-anchored δ peptide (8). The α2 peptide contains the structural components for channel stimulation, while the δ peptide has regions important for the shift in voltage-dependent activation, steady-state inactivation, and the regulation of inactivation kinetics.

 

Amino acids 292-467 of the α2δ2 subunit comprises a von Willebrand factor A (VWFA) domain (amino acids 292-467). VWFA domains are often found in extracellular matrix proteins, where they regulate cell adhesion (9). Within the VWFA domain is a metal ion-dependent adhesion site (MIDAS) motif (amino acids 300-304) that regulates exocytosis and trafficking of the α2 peptide (10;11). Amino acids 488-577 of the α2δ2 subunit comprise a Cache (calcium channels and chemotaxis receptors) domain, which mediates small-molecule recognition (12).

 

Cacna2d2 undergoes alternative splicing to generate three protein variants (13). Cacna2d2 can undergo alternative splicing in the region of the a2 subunit between residues 661/663, resulting in the addition of eight amino acids. Within the δ peptide is a second region of alternative splicing that results in the addition of three different residues (13). The functions of the protein variants are unknown.

 

The hera mutation results in a valine (V) to alanine (A) substitution at position 317 (V317A). V317 is within the extracellular VWFA domain in the α2 peptide.

Expression/Localization

Cacna2d2 is expressed in the brain, kidney, testis, pancreas, lung, skeletal muscle, liver, placenta, and heart (13-19). In the brain, Cacna2d2 is highly expressed in the cerebellum, with less expression observed in the medulla, pons, striatum, cortex, and hippocampus. In the cerebellum, the α2δ2 subunit is localized to lipid rafts (20).

Background
Figure 5. Calcium regulates muscle contraction. The AChR regulates the flow of ions across the cell membrane to mediate synaptic transmission at the neuromuscular junction. A detailed description of the function of AChR is detailed in the key below the figure.
Figure 6. Glutamate-stimulated signaling through mGluR7 and mGluR1a. Upon presynaptic depolarization, Ca2+ enters the presynapse through voltage-dependent Ca2+ channels (VDCCs) and induces glutamate release and CaM activation. Upon G-protein activation, PKC is recruited to mGluR7 through binding to PICK1. Activation of mGluR7 results in inhibition of adenylate cyclase activity (i.e., the formation of cAMP and ATP), the attenuation of N-type VGCCs, the activation of K+ channels, and the subsequent decrease in neurotransmitter (glutamate and GABA) release. See the record shaky for more details about mGluR7-associated signaling. Upon stimulation by glutamate, mGluR1s in the post-synaptic membrane couple to multiple signaling pathways through different G proteins. Several second messenger systems are activated upon mGluR1 activation including PKB, PLCγ, PI3K/AKT/mTOR, IP3/DAG, NFκB and CaM. The C-terminus of mGluR1 interacts with Homer proteins, which facilitate the association of mGluR1 with IP3 receptors in the endoplasmic reticulum. Activation of these signaling pathways result in cell survival (PKC/PLD), proliferation (PKC/ERK1/2), learning, memory, and long-term potentiation (CaM), synaptic remodeling and plasticity (cAMP, PI3K/AKT/mTOR). See the record for donald for more details on the signaling pathways activated downstream of mGluR1a.

Ca2+ signaling is essential for development, proliferation, neuronal transmission, learning and memory, muscle contraction, cell motility, cell growth, and cell death as well as regulation of enzyme activity, permeability of ion channels, and activity of ion pumps [reviewed in (21)].

 

Certain signals trigger an increase in the cytoplasmic Ca2+ (from 10-100 nM to 500-1000 nM) through the release of Ca2+ from stores in the endoplasmic or sarcoplasmic reticulum.  Cytoplasmic Ca2+ concentrations are often increased through stimulation of the phospholipase C (PLC) signaling pathway by cell surface receptors. PLC hydrolyzes PIP2 to produce the second messengers diacylglycerol (DAG) and IP3.  DAG is responsible for activating protein kinase C (PKC; see the record for Untied) and possibly the transient receptor potential (TRP) calcium influx channels (see the record for gingame for information about TRPV5), while IP3 modulates calcium responses within the cell by binding to receptors on the intracellular membrane to allow the mobilization of intracellular calcium.  Depletion of Ca2+ from the ER results in Ca2+ entry from outside the cell by store-operated channels (SOCs). Ca2+ often binds the regulatory protein calmodulin (CaM), which subsequently activates Ca2+/CaM-dependent protein kinases or other effector proteins.

 

Maintenance of Ca2+ levels in the cell requires methods of Ca2+ extrusion systems at the plasma membrane that compensate for the influx of Ca2+ from the extracellular space. Malfunction of Ca2+ transport across membranes can often result in Ca2+ overload and cell death. The Na+/Ca2+ exchanger, ATP-dependent transporters (i.e., Sarcoplasmic/Endoplasmic Reticular Ca2+-ATPases (SERCAs) in the ER, Secretory Pathway Ca2+-ATPases (SPCAs) at the Golgi apparatus, Plasma Membrane Ca2+ ATPases (PMCAs)), the mitochondrial Ca2+ uniporter, and a variety of Ca2+ binding and buffering proteins function in the regulation of Ca2+ homeostasis in the cell by mediating Ca2+ influx in the cytosol or to the lumen of organelles.

 

VDCCs mediate Ca2+ entry into muscle, glial cells, neurons, and endocrine cells (Table 1). In cardiac and smooth muscle cells, activation of Ca2+ channels results in contraction by increasing cytosolic Ca2+ concentration as well as by activating Ca2+-dependent Ca2+ release by ryanodine-sensitive Ca2+ release channels in the sarcoplasmic reticulum (Figure 5). In neurons, Ca2+ influx mediates synaptic neurotransmitter release (Figure 6). At resting membrane potential, VDCCs are closed. The VDCCs are opened/activated by depolarized membrane potential. Calcium enters the cell rapidly upon channel opening. Voltage-dependent Ca2+ channels in endocrine cells mediate Ca2+ influx which initiates secretion of hormones. The α2δ subunits regulate VDCC channel function by increasing the calcium current density, shifting the voltage dependence of activation to more negative potentials, or by increasing steady-state inactivation (13;22).

 

Calcium signaling is involved in several processes that lead to cancer development including cell growth, apoptosis resistance, increased angiogenesis, and invasion. CACNA2D2 is a predicted tumor suppressor gene that is purported to link calcium signaling to the pathogenesis of some cancers. In humans, CACNA2D2 is in a region of chromosome 3p21.3 that is often deleted in lung, breast, and other cancers (18;23). Exogenous expression of α2δ2 in non-small cell lung cancer cell lines induced apoptosis (24). In LNCaP prostate cancer cells, overexpression of α2δ2 resulted in nuclear factor of activated T cells (NFAT) activity and cell proliferation (25). During prostate cancer progression, α2δ2 expression is upregulated (25).

 

A mutation in CACNA2D2 (p.Leu1040Pro) has been detected in epileptic encephalopathy (26). A patient with a CACNA2D2 mutation exhibited epilepsy, dyskinesia, cerebellar atrophy, and psychomotor delay.

Putative Mechanism

A spontaneous mutation in Cacna2d2 resulting in loss of full-length α2δ2 expression was identified in the ducky mouse strain (14). The ducky mice exhibited ataxia, paroxysmal dyskinesia, reduced body size, and premature death by postnatal day 35. The mice exhibited defective development of portions of the central nervous system including the cerebellum, medulla, and spinal cord. The ducky mice displayed bilaterally synchronous spike-wave discharges that led to behavioral arrest. The ducky mice also exhibited epileptic seizures. Other Cacna2d2 mutant mouse models (e.g., Cacna2d2du-2j, Cacna2d2ent, Cacna2d2du-3J, Cacna2d2du-td, and Cacna2d2tm1NCIF) also exhibited ataxia, reduced body size, seizures, and paroxysmal dyskinesia (14;15;27-29). In the Cacna2d2du-td mouse model, growth defects in the mutant mice were attributed to deficient prolactin cells in the pituitary (30). Prolactin is a hormone with many functions including in reproduction, metabolism, osmoregulation, immunoregulation, and behavior. Similar to other Cacna2d2 mouse models, the hera mice also exhibit reduced body weight. Neurological phenotypes in the hera mice were not observed.

Primers PCR Primer
hera(F):5'- AAGGACATGGTCATCATTGTGG -3'
hera(R):5'- GCCTTCTCGTTGAACTGTGG -3'

Sequencing Primer
hera_seq(F):5'- ACATGGTCATCATTGTGGATGTG -3'
hera_seq(R):5'- CTCGTTGAACTGTGGGGACAG -3'
References
  30. Dung, H. C. (1975) Growth Retardation, High Mortality, and Low Reproductivity of Neurological Mutant Mice. Anat Rec. 181, 347-348.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsZhe Chen, Takuma Misawa, Jeff SoRelle, Jianhui Wang