Phenotypic Mutation 'infinitesimal'

• Allele: infinitesimal
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 56,756,075 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Kbtbd2
• Gene Name: kelch repeat and BTB (POZ) domain containing 2
• Synonym(s): Bklhd1
• Chromosomal Location: 56,754,510-56,774,798 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice homozygous for a knock-out allele or mutation exhibit diabetes, lipodystrophy, and hepatic steatosis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Histidine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000109960] [ENSMUSP00000109962]
• AlphaFold: G3X9X1
• SMART Domains: Protein: ENSMUSP00000109960; Gene: ENSMUSG00000059486; AA Change: Y554H

Domain	Start	End	E-Value	Type
BTB	31	128	1.5e-28	SMART
BACK	133	235	7.34e-27	SMART
Kelch	317	380	7.31e0	SMART
Kelch	381	429	4.33e-4	SMART
Kelch	430	469	2.7e0	SMART
Kelch	470	532	7.7e0	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
  (Using ENSMUST00000114321)
• SMART Domains: Protein: ENSMUSP00000109962; Gene: ENSMUSG00000059486; AA Change: Y554H

Domain	Start	End	E-Value	Type
BTB	31	128	1.5e-28	SMART
BACK	133	235	7.34e-27	SMART
Kelch	317	380	7.31e0	SMART
Kelch	381	429	4.33e-4	SMART
Kelch	430	469	2.7e0	SMART
Kelch	470	532	7.7e0	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
  (Using ENSMUST00000114323)
• Meta Mutation Damage Score: 0.9178
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 2/2
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, gDNA
• Last Updated: 2019-09-04 9:45 PM by Anne Murray
• Record Created: 2015-06-16 1:32 PM by Jeff SoRelle
• Record Posted: 2016-10-13
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Zhe Chen, Takuma Misawa, Jeff SoRelle, Jianhui Wang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_145958; MGI:2384811

Alleles Listed at MGI

All alleles(43) : Targeted(2) Gene trapped(41)

Phenotypic Description

Figure 1. The infinitesimal mice have reduced body weights. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The infinitesimal phenotype was identified among G3 mice of the pedigree R2146, some of which showed reduced body weights (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 91 mutations (X-axis) identified in the G1 male of pedigree R2146. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 91 mutations. The body weight phenotype was linked to a mutation in Kbtbd2: a T to C transition at base pair 56,779,090 (v38) on chromosome 6, equivalent to base pair 19,186 in the GenBank genomic region NC_000072.  Linkage was found with a recessive model of inheritance (P = 3.044 x 10^-6), wherein 2 homozygous variants departed phenotypically from 15 homozygous reference and 14 heterozygous mice (Figure 2).

The mutation corresponds to residue 2,303 in the NM_145958 mRNA sequence in exon 4 of 4 total exons.

2288 TATGTCACCTACCAGTATGATTTGGAACTTGAC 549  -Y--V--T--Y--Q--Y--D--L--E--L--D-

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to histidine (H) substitution at position 554 (Y554H) in the KBTBD2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.996).

Protein Prediction

Figure 3. Domain structure of the KBTBD2 protein. KBTBD2 is a member of the BTB-BACK-kelch protein family. The infinitesimal mutation (Y554H) is indicated. Abbreviations: NTE, N-terminal extension; BTB, Broad-complex, Tramtrack and Bric à brac domain; BACK, BTB and C-terminal kelch domain. The image is interactive; click to view additional mutations in KBTBD2. Click on the mutation to connect to the mutation page.

Kbtbd2 encodes KBTBD2, a member of the BTB (Broad-complex, Tramtrack and Bric à brac)-BACK (BTB and C-terminal kelch)-Kelch (BBK) family of proteins. KBTBD2 contains an N-terminal extension (amino acids 1-30), BTB domain (amino acids 31-128; SMART), a BACK domain (amino acids 133-235) and five kelch repeats (amino acids 317-380, 381-429, 430-469, and 470-532, SMART; (1-3)); Figure 3).

The infinitesimal mutation (Y554H) is within an undefined region of the C-terminal portion of the KBTBD2 protein following the Kelch domains.

For more information about Kbtbd2, please see the record for teeny.

Putative Mechanism

KBTBD2 interacts with the E3 ubiquitin ligase Cul3 through the KBTBD2 N-terminal BTB domain, indicating that it functions as a substrate recognition component of Cul3-based ubitquitin ligase complexes. KBTBD2 binds exclusively to p110-free p85α, leading to its Ub-mediated degradation. KBTBD2 recruits p85α to Cul3 Ub ligase complexes for K48-linked ubiquitination, leading to proteasome-mediated degradation of p85α (4). PI3K signaling in response to insulin is impaired in KBTBD2-deficient mice owing to increased amounts of p85α, and that accumulated p85α causes the infinitesimal phenotype.

Primers

PCR Primer
infinitesimal_pcr_F: GGCGGAAGTGCAACCATTTC
infinitesimal_pcr_R: CTGGCACTGTAGATGGGTCTTC

Sequencing Primer
infinitesimal_seq_F: GGAAGTGCAACCATTTCCCCATC
infinitesimal_seq_R: CTGTAGATGGGTCTTCAGTAACTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 6, - strand):

1   ctggcactgt agatgggtct tcagtaactg tggaaattta tgatgtgaat aaaaatgaat
61  ggaagatggc tgccaacatc cctgctaaaa ggtattctga tccctgtgtt agagctgttg
121 tgatctcaaa ttctctttgt gtgtttatgc gagaaaccca cttaaatgaa cgagctaagt
181 atgtcaccta ccagtatgat ttggaacttg accggtggtc tctgcggcag catatatctg
241 aacgtgtact gtgggaccta gggagagatt ttcggtgcac tgtggggaaa ctttatccat
301 cctgtcttga agaatctcca tggaagccac caacttacct tttttcacca gatggaacag
361 aggagtttga actggatggg gaaatggttg cacttccgcc 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Stogios, P. J., Downs, G. S., Jauhal, J. J., Nandra, S. K., and Prive, G. G. (2005) Sequence and Structural Analysis of BTB Domain Proteins. Genome Biol. 6, R82.

  2. Prag, S., and Adams, J. C. (2003) Molecular Phylogeny of the Kelch-Repeat Superfamily Reveals an Expansion of BTB/kelch Proteins in Animals. BMC Bioinformatics. 4, 42.

  3. Perez-Torrado, R., Yamada, D., and Defossez, P. A. (2006) Born to Bind: The BTB Protein-Protein Interaction Domain. Bioessays. 28, 1194-1202.

  4. Zhang, Z., Turer, E., Li, X., Zhan, X., Choi, M., Tang, M., Press, A., Smith, S. R., Divoux, A., Moresco, E. M., and Beutler, B. (2016) Insulin Resistance and Diabetes Caused by Genetic Or Diet-Induced KBTBD2 Deficiency in Mice. Proc Natl Acad Sci U S A. .