Phenotypic Mutation 'daffodil'

• Allele: daffodil
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 22,488,282 bp (GRCm39)
• Base Change: T ⇒ G (forward strand)
• Gene: Atp7b
• Gene Name: ATPase, Cu++ transporting, beta polypeptide
• Synonym(s): Atp7a, WND, Wilson protein
• Chromosomal Location: 22,482,801-22,550,321 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008] ; PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 21992785 - 22060305 bp
• Amino Acid Change: Threonine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000006742] [ENSMUSP00000106366]
• AlphaFold: Q64446
• SMART Domains: Protein: ENSMUSP00000006742; Gene: ENSMUSG00000006567; AA Change: T1217P

Domain	Start	End	E-Value	Type
Pfam:HMA	71	132	8.8e-14	PFAM
Pfam:HMA	156	217	6.6e-13	PFAM
Pfam:HMA	271	329	7.4e-13	PFAM
Pfam:HMA	364	425	1.1e-10	PFAM
Pfam:HMA	493	554	2.3e-14	PFAM
Pfam:HMA	569	630	3.1e-15	PFAM
transmembrane domain	656	675	N/A	INTRINSIC
Pfam:E1-E2_ATPase	770	1018	3.3e-60	PFAM
Pfam:Hydrolase	1023	1276	1.3e-67	PFAM
Pfam:HAD	1026	1273	4.6e-10	PFAM
Pfam:Hydrolase_3	1243	1308	5.1e-7	PFAM
transmembrane domain	1322	1344	N/A	INTRINSIC
low complexity region	1353	1370	N/A	INTRINSIC
low complexity region	1418	1437	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000006742)
• SMART Domains: Protein: ENSMUSP00000106366; Gene: ENSMUSG00000006567; AA Change: T1102P

Domain	Start	End	E-Value	Type
Pfam:HMA	59	120	1.2e-13	PFAM
Pfam:HMA	144	205	9.7e-12	PFAM
PDB:2AW0|A	259	314	6e-6	PDB
Pfam:HMA	378	439	1.6e-13	PFAM
Pfam:HMA	454	515	1.5e-15	PFAM
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:E1-E2_ATPase	656	904	4.6e-50	PFAM
Pfam:Hydrolase	908	1161	6.6e-76	PFAM
Pfam:HAD	911	1158	1.5e-15	PFAM
Pfam:Hydrolase_3	1128	1193	8.5e-7	PFAM
transmembrane domain	1207	1229	N/A	INTRINSIC
low complexity region	1238	1255	N/A	INTRINSIC
low complexity region	1303	1322	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000110738)
• Meta Mutation Damage Score: 0.9538
• Is this an essential gene?: Possibly essential (E-score: 0.602)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:45 PM by Anne Murray
• Record Created: 2015-06-19 4:09 PM by Jin Huk Choi
• Record Posted: 2017-01-06
• Science Writers: Nora G. Smart, Anne Murray
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Jin Huk Choi, Kuan-wen Wang, Emre Turer, Bruce Beutler

Accession Number

NCBI RefSeq: NM_007511; MGI:103297

Alleles Listed at MGI

All Mutations and Alleles(4) : Spontaneous(2) Targeted(2)

Phenotypic Description

Figure 1. Serum samples of C57BL/6J mice and a daffodil mouse (D4143).

Figure 2. Peripheral blood lymphocyte frequencies in wild-type (REF), daffodil heterozygotes (HET), and daffodil homozygotes (VAR).

The daffodil phenotype was identified among G3 mice of the pedigree R2256, some of which showed strong yellow pigmentation in the serum (Figure 1). Peripheral blood immune cell frequencies were normal in the daffodil mice (Figure 2).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 101 mutations. Among these, only one affected a gene with known effects on liver function, Atp7b. The mutation in Atp7b is an A to C transversion at base pair 21,998,266 (v38) on chromosome 8, or base pair 61,809 in the GenBank genomic region NC_000074 encoding Atp7b. The mutation corresponds to residue 3,668 in the NM_007511 mRNA sequence in exon 17 of 21 total exons. 

3653 GATGTGGCTCTGATCACAGGGGACAACCGGAAG 1213 -D--V--A--L--I--T--G--D--N--R--K-

The mutated nucleotide is indicated in red. The mutation results in a threonine (T) to proline (P) substitution at position 1,217 (T1217P) in the ATP7B protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain organization and function of ATP7B. Domain structure. MBD1-MBD6 represent the N-terminal metal binding domains with the Cu-binding cysteines indicated. The canonical A-domain and P-domain residues are also indicated. The LL motif in the C-terminal tail is necessary for subcellular localization of ATP7A. Conversion of ATP to ADP by the N-domain leads to phosphorylation of the P-domain and copper transport. The A-domain dephosphorylates the P-domain. Numbers 1, 2, and 3 indicate the order of copper binding and transport (see text). The daffodil mutation results in a threonine (T) to proline (P) substitution at position 1,217 (T1217P).

Figure 4. ATP7A and ATP7B copper transport cycle. ATP7A is shown for reference. (1) In its basal state, ATP7B is localized in the trans-Golgi network (TGN). In response to raised copper concentration within the cell, ATP7B relocalizes to vesicles. (2) Copper then binds to the MB domain of ATP7B, followed by (3) ATP binding to the N domain. (4) Copper is transferred and binds to the 7th transmembrane domain followed by (5) ATP hydrolysis and P domain phosphorylation. (6) Copper is released  across the vesicle membrane to be exocytosed from the cell, stimulating (7) the dephosphorylation of the P domain. (8) ATP7B is recycled back to the TGN.

Figure 5.  Crystal structure of a P-type ATPase (class IB; PIB), CopA (alternatively, Lpg1024), from Legionella pneumonphila (PDB: 3RFU). CopA has significant sequence identity to human ATP7A and has copper-dependent ATPase activity in vitro.

Atp7b encodes the 1,462-amino acid mouse copper-transporting ATPase ATP7B. ATP7B is a large eight transmembrane-spanning protein belonging to the large family of P-type ATPases, along with the closely-related copper-transportase ATP7A (see the record for Tigrou-like) (Figure 3). ATP7B and ATP7A (also known as Cu-ATPases) and related proteins, form the P_1b-ATPases subgroup within this family based on distinct structural and mechanistic characteristics (1). Cu-ATPases transport copper from the cytosol across cellular membranes using the energy of ATP hydrolysis. In this catalytic cycle, binding of copper to the N-terminal metal binding domains (MBD) occurs first, followed by binding of ATP to the nucleotide-binding (N)-domain (Figure 4). ATP hydrolysis and phosphorylation of the phosphorylation (P)-domain then occurs. Finally copper is translocated and the P-domain is dephosphorylated by the actuator (A)-domain (2). The central step in the catalytic cycle is the formation of a transient phosphorylated intermediate by transfer of γ-phosphate from ATP to the invariant aspartic acid residue in the DKTG motif located in the P-domain. This reaction is dependent upon the binding of copper to sites within the transmembrane portion of the enzyme, while the release of copper from these sites stimulates dephosphorylation (2-4). 

Both ATP7B and ATP7A contain six MBDs at the N-terminus. Each domain contains a sequence motif with two copper-coordinating cysteines. Copper binds as a reduced Cu(I) ion to each of these domains, although some studies suggest that the entire N-terminal region of ATP7A binds a total of four copper ions and that the metal binding sites can be functionally redundant (5-7). Studies of ATP7B suggest that copper binding to this area of both Cu-ATPases is needed for the ATPase catalytic cycle. In the absence of copper, the N-terminal region of these proteins interacts with the N-domain and prevents ATP from binding. Copper binding to the MBDs disrupts this inhibition (8). It is thought that the the two MBDs closest to the membrane (MBD5 and MBD6) are most important for the functional activity of these proteins, while the other MBDs play an autoinhibitory role. At least one of these two sites needs to bind copper in order for copper transport to occur (2;3). Structural information on individual MBDs of ATP7A has been obtained using nuclear magnetic resonance (NMR) studies that revealed that these domains form compactly folded structures with a βαββαβ-fold, similar to ferredoxin (see PDB ID 1Y3J as an example). The copper-binding cysteines are located in the βα-loop and the N-terminal portion of the first α-helix and are exposed at the protein surface. Conserved hydrophobic residues in the MBDs are located adjacent to the copper-binding motifs and form a hydrophobic core, which is likely to stabilize the metal-protein complex (3;9;10).

The other domains present in ATP7B are the M domain consisting of the eight transmembrane segments, the A-domain, the P-domain, and the N-domain. All of the domains for the Cu-ATPases are located in the cytosol except for the transmembrane domains that form a channel in the cell membrane through which copper can be transported. The sixth TM contains a highly conserved CPC sequence that characterizes P_1b-ATPases. This motif, as well as the conserved YNMS motif present in TM7 and 8, are thought to bind copper during transport through the channel (3). The P-domain of the Cu-ATPases is relatively conserved with other P-type ATPases and contains sequences critical for ATP hydrolysis (2;3). By contrast, the N-domain contains little homology to other P-type ATPases at the amino acid level, but retains a similar three-dimensional structure (11). The A-domain of all P-type ATPases, including ATP7B and ATP7A, contain a TGE sequence motif that is essential for dephosphorylating the P-domain. Mutation of this motif in ATP7A results in hyperphosphorylation of the protein (12). The C-terminal tail of ATP7A contains a C-terminal di-leucine, which is essential for localization of ATP7A/B within the trans-golgi network (TGN) (see Expression/Localization) (13;14).

The crystal structure of a P-type ATPase (class IB; PIB), CopA (alternatively, Lpg1024), from Legionella pneumonphila has been solved at a 3.2 Å resolution [PDB: 3RFU; (15); Figure 5]. CopA has significant sequence identity to human ATP7A and has copper-dependent ATPase activity in vitro (15). The crystal structure is residues Val74 to the carboxy-terminal Leu736; the N-terminal 73 amino acids not crystallized are part of a single MBD and are not involved in CopA ATPase activity. The cytosolic portion of CopA has all of the characteristic domains of P-type ATPases including the A-domain, P-domain, and N-domain; the core structures are conserved between CopA and other P-type ATPases (15). The M-domain of CopA has eight transmembrane (TM) segments comprised of six core helices that are organized similar to other P-type ATPases (16-18); the TM segments are preceded by two PIB-specific helices. The A-domain is the cytosolic loop between the second and third TM segment (15). The two PIB-specific helices interact with TM2 and TM6 or with TM1 and TM2, respectively (15). Examination of the membrane copper-binding sites determined that with the exception of one residue (Pro383 in CopA, Pro308 in the type II ATPase SERCA1a) within the fourth transmembrane segment, the other residues involved in ion binding in class II ATPases are not conserved in the PIB ATPases (15).

The rat ATP7B gene has a cell type-specific promoter downstream of exon 8 that generates a presumptive ATPase, named PINA (pineal night-specific ATPase). PINA is retina- and pineal gland-specific, and its expression level is correlated with circadian rhythm (19). PINA does not have the MBD domains or the first four transmembrane domains. The function of PINA is unknown. Atp7b encodes several alternatively spliced isoforms (20). One of the isoforms is the result of an in-frame deletion of exons 6, 7, 8, and 12, which encodes a 1258-amino acid protein that is predominantly expressed in the brain (20;21).

The daffodil mutation is in the cytoplasmic loop between transmembrane domains six and seven.

Expression/Localization

In adult humans, ATP7B and ATP7A mRNA expression is somewhat complementary, with ATP7A expressed in the majority of tissues except for the liver, and ATP7B expressed primarily in the liver, but also in the kidney and placenta, and at lower levels in brain, heart, mammary gland, ovary, and lungs (21-24). These differences suggest tissue-specific functions for each Cu-ATPase. The subcellular location of Cu-ATPases changes dynamically in many tissues depending on the needs of the body or tissue for copper transport. Under basal conditions, ATP7B and ATP7A and are localized to the final compartment of the Golgi apparatus, the trans-Golgi network (3;13;25-27). A shorter ATP7B isoform is expressed primarily in the brain, but not in liver, and it is localized in the cytosol (20;28).

Background

Copper is an essential micronutrient for all organisms because it functions as a cofactor for enzymes that catalyze redox reactions used in fundamental metabolic processes. It is required for numerous cellular processes, including mitochondrial respiration, antioxidant defense, neurotransmitter synthesis, connective tissue formation, pigmentation, peptide amidation, macrophage responses to dermal wounds (29), PDGF-induced vascular smooth muscle cell migration during neointimal formation (30), and iron metabolism [reviewed in (2)]. However, because of its redox properties copper can generate damaging free radicals and all organisms are faced with the challenge of acquiring sufficient copper for cellular requirements, while avoiding accumulation to levels that could lead to cellular toxicity. Copper homeostatic mechanisms involve an intricate balance between uptake, distribution and utilization, storage and detoxification, and efflux pathways (3;25). In the hepatocyte, ATP7B delivers copper to apo-ceruloplamin within the Golgi (31) and also transports excess copper out of the cell and into the bile canaliculus for excretion from body via the bile (32). During conditions of high intracellular hepatic copper, ATP7B traffics towards the apical membrane where it sequesters copper in sub-apical vesicles (33-35). In the placenta, ATP7B exports excess copper via the apical membrane to the maternal circulation to maintain placental copper homeostasis (36). The role of ATP7B in other organs is unknown.

ATP7B and ATP7A have a dual role in cells: to provide copper to essential cuproenzymes and to mediate the excretion of excess intracellular copper. Among these copper-dependent proteins is the ferroxidase ceruloplasmin, which functions in iron and copper transport throughout the body (2;3). Other ubiquitously expressed copper-dependent enzymes include cytochrome c oxidase, necessary for mitochondrial respiration, and superoxide dismutase, which contributes to antioxidant defense and modulates levels of extracellular superoxide ions in the vasculature (3;37). Tissue-specific enzymes include dopamine β-hydroxylase (necessary for catecholamine production in the adrenals), lysl oxidase (important for connective tissue formation), peptidylglycine α-amidating mono-oxygenase (important in peptide amidation in the pituitary), and tyrosinase [critical for pigment formation in skin, hair and eyes (mutated in ghost)] [reviewed in (2;3;25)]. Mutations in both ATP7B and ATP7A in humans result in diseases associated with alterations in copper homeostasis (2;3;25). Mutations in ATP7B can cause Wilson disease (WD; OMIM #277900), characterized by intracellular hepatic copper excess due to impaired biliary copper efflux. Patients with Wilson disease also exhibit copper accumulation in the brain and cornea, which subsequently leads to cell toxicity. Patients with Wilson disease often develop hepatitis and/or cirrhosis. Approximately 40% of the Wilson disease patients manifest neurological and/or psychiatric disorders.

Putative Mechanism

Atp7b-deficient (Atp7b^-/-) mice exhibit a gradual accumulation of hepatic copper (i.e., elevated 27-fold by one month of age and 50-fold by two months, and 60-fold by five months of age) (38). Copper concentration was also increased in the kidney, brain, placenta, and lactating mammary glands. The Atp7b^-/- mice exhibit cirrhosis-like liver abnormalities after approximately 7 months of age. Litters from Atp7b^-/- females exhibited tremor, ataxia, abnormal locomotor behavior, and growth retardation that is often observed in copper deficiency. In newborn Atp7b^-/- mice, the concentration of copper was reduced. The Atp7b^-/- construct was designed to leave the PINA transcript intact. Long Evans Cinnamon (LEC) rats have a deletion in the 3’ portion of the ATP7B gene (39). Toxic milk mice have a point mutation in the 3’ end of Atp7b that results in mutation of a conserved residue in the last transmembrane domain (40). Both the LEC rat and toxic milk mouse strain have hepatic copper accumulation and liver damage (41-46), but neurological, behavioral, and endocrine pathologies have not been reported. The LEC and toxic milk strains are predicted to alter both the full-length ATP7B and the PINA protein products. The phenotype of the daffodil mice indicates that there is a loss of ATP7B^daffodil function in the liver. Neurological and behavioral phenotypes were not observed in the daffodil mice at the ages they were examined.

Primers

PCR Primer
daffodil_pcr_F: AGCACTCCCGTAATACAGTG
daffodil_pcr_R: GAGCCATCTTGCTTGCACAG

Sequencing Primer
daffodil_seq_F: CCTGGAACTTGCTATATAGACCAGG
daffodil_seq_R: ATCTTGCTTGCACAGAGCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 482 nucleotides is amplified (chromosome 8, - strand):

1   gagccatctt gcttgcacag agctgcctgg gcctgctctt gctgattgct gttgcttggt
61  tccaggtgtg ctctgcggga tgatcgccat cgcagatgct gtcaaaccag aggctgccct
121 ggctatctac accctgaaaa gcatgggtgt ggatgtggct ctgatcacag gggacaaccg
181 gaagacagcc agagccattg ctactcaggt agggcagtgg ccaggcattc tttgtccttg
241 gaaatttgta gacaagctca cagatggaaa aaaaaaagat ctaaacatct gatgtaaaag
301 cacactttta attccagcac tctgaggcag aggcaggtgg acctctgagt tccaggtcag
361 cctggtctat atagcaagtt ccaggcagcc acagctacac tgagaccttg tctcaaaaac
421 aaaccaaaat aaacagacaa tgacaacaag ccatcattta agcactgtat tacgggagtg
481 ct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Arnesano, F., Banci, L., Bertini, I., Ciofi-Baffoni, S., Molteni, E., Huffman, D. L., and O'Halloran, T. V. (2002) Metallochaperones and Metal-Transporting ATPases: A Comparative Analysis of Sequences and Structures. Genome Res. 12, 255-271.

  2. de Bie, P., Muller, P., Wijmenga, C., and Klomp, L. W. (2007) Molecular Pathogenesis of Wilson and Menkes Disease: Correlation of Mutations with Molecular Defects and Disease Phenotypes. J Med Genet. 44, 673-688.

  3. Lutsenko, S., Barnes, N. L., Bartee, M. Y., and Dmitriev, O. Y. (2007) Function and Regulation of Human Copper-Transporting ATPases. Physiol Rev. 87, 1011-1046.

  4. Voskoboinik, I., Mar, J., Strausak, D., and Camakaris, J. (2001) The Regulation of Catalytic Activity of the Menkes Copper-Translocating P-Type ATPase. Role of High Affinity Copper-Binding Sites. J Biol Chem. 276, 28620-28627.

  5. Jensen, P. Y., Bonander, N., Horn, N., Tumer, Z., and Farver, O. (1999) Expression, Purification and Copper-Binding Studies of the First Metal-Binding Domain of Menkes Protein. Eur J Biochem. 264, 890-896.

  6. Cobine, P. A., George, G. N., Winzor, D. J., Harrison, M. D., Mogahaddas, S., and Dameron, C. T. (2000) Stoichiometry of Complex Formation between Copper(I) and the N-Terminal Domain of the Menkes Protein. Biochemistry. 39, 6857-6863.

  7. Voskoboinik, I., Strausak, D., Greenough, M., Brooks, H., Petris, M., Smith, S., Mercer, J. F., and Camakaris, J. (1999) Functional Analysis of the N-Terminal CXXC Metal-Binding Motifs in the Human Menkes Copper-Transporting P-Type ATPase Expressed in Cultured Mammalian Cells. J Biol Chem. 274, 22008-22012.

  8. Tsivkovskii, R., MacArthur, B. C., and Lutsenko, S. (2001) The Lys1010-Lys1325 Fragment of the Wilson's Disease Protein Binds Nucleotides and Interacts with the N-Terminal Domain of this Protein in a Copper-Dependent Manner. J Biol Chem. 276, 2234-2242.

  9. Banci, L., Bertini, I., Cantini, F., DellaMalva, N., Herrmann, T., Rosato, A., and Wuthrich, K. (2006) Solution Structure and Intermolecular Interactions of the Third Metal-Binding Domain of ATP7A, the Menkes Disease Protein. J Biol Chem. 281, 29141-29147.

  10. Jones, C. E., Daly, N. L., Cobine, P. A., Craik, D. J., and Dameron, C. T. (2003) Structure and Metal Binding Studies of the Second Copper Binding Domain of the Menkes ATPase. J Struct Biol. 143, 209-218.

  11. Dmitriev, O., Tsivkovskii, R., Abildgaard, F., Morgan, C. T., Markley, J. L., and Lutsenko, S. (2006) Solution Structure of the N-Domain of Wilson Disease Protein: Distinct Nucleotide-Binding Environment and Effects of Disease Mutations. Proc Natl Acad Sci U S A. 103, 5302-5307.

  12. Petris, M. J., Voskoboinik, I., Cater, M., Smith, K., Kim, B. E., Llanos, R. M., Strausak, D., Camakaris, J., and Mercer, J. F. (2002) Copper-Regulated Trafficking of the Menkes Disease Copper ATPase is Associated with Formation of a Phosphorylated Catalytic Intermediate. J Biol Chem. 277, 46736-46742.

  13. Petris, M. J., Camakaris, J., Greenough, M., LaFontaine, S., and Mercer, J. F. (1998) A C-Terminal Di-Leucine is Required for Localization of the Menkes Protein in the Trans-Golgi Network. Hum Mol Genet. 7, 2063-2071.

  14. Greenough, M., Pase, L., Voskoboinik, I., Petris, M. J., O'Brien, A. W., and Camakaris, J. (2004) Signals Regulating Trafficking of Menkes (MNK; ATP7A) Copper-Translocating P-Type ATPase in Polarized MDCK Cells. Am J Physiol Cell Physiol. 287, C1463-71.

  15. Gourdon, P., Liu, X. Y., Skjorringe, T., Morth, J. P., Moller, L. B., Pedersen, B. P., and Nissen, P. (2011) Crystal Structure of a Copper-Transporting PIB-Type ATPase. Nature. 475, 59-64.

  16. Morth, J. P., Pedersen, B. P., Toustrup-Jensen, M. S., Sorensen, T. L., Petersen, J., Andersen, J. P., Vilsen, B., and Nissen, P. (2007) Crystal Structure of the Sodium-Potassium Pump. Nature. 450, 1043-1049.

  17. Pedersen, B. P., Buch-Pedersen, M. J., Morth, J. P., Palmgren, M. G., and Nissen, P. (2007) Crystal Structure of the Plasma Membrane Proton Pump. Nature. 450, 1111-1114.

  18. Toyoshima, C., Nakasako, M., Nomura, H., and Ogawa, H. (2000) Crystal Structure of the Calcium Pump of Sarcoplasmic Reticulum at 2.6 A Resolution. Nature. 405, 647-655.

  19. Li, X., Chen, S., Wang, Q., Zack, D. J., Snyder, S. H., and Borjigin, J. (1998) A Pineal Regulatory Element (PIRE) Mediates Transactivation by the pineal/retina-Specific Transcription Factor CRX. Proc Natl Acad Sci U S A. 95, 1876-1881.

  20. Petrukhin, K., Lutsenko, S., Chernov, I., Ross, B. M., Kaplan, J. H., and Gilliam, T. C. (1994) Characterization of the Wilson Disease Gene Encoding a P-Type Copper Transporting ATPase: Genomic Organization, Alternative Splicing, and structure/function Predictions. Hum Mol Genet. 3, 1647-1656.

  21. Tanzi, R. E., Petrukhin, K., Chernov, I., Pellequer, J. L., Wasco, W., Ross, B., Romano, D. M., Parano, E., Pavone, L., and Brzustowicz, L. M. (1993) The Wilson Disease Gene is a Copper Transporting ATPase with Homology to the Menkes Disease Gene. Nat Genet. 5, 344-350.

  22. Vulpe, C., Levinson, B., Whitney, S., Packman, S., and Gitschier, J. (1993) Isolation of a Candidate Gene for Menkes Disease and Evidence that it Encodes a Copper-Transporting ATPase. Nat Genet. 3, 7-13.

  23. Bull, P. C., Thomas, G. R., Rommens, J. M., Forbes, J. R., and Cox, D. W. (1993) The Wilson Disease Gene is a Putative Copper Transporting P-Type ATPase Similar to the Menkes Gene. Nat Genet. 5, 327-337.

  24. Chelly, J., Tumer, Z., Tonnesen, T., Petterson, A., Ishikawa-Brush, Y., Tommerup, N., Horn, N., and Monaco, A. P. (1993) Isolation of a Candidate Gene for Menkes Disease that Encodes a Potential Heavy Metal Binding Protein. Nat Genet. 3, 14-19.

  25. La Fontaine, S., and Mercer, J. F. (2007) Trafficking of the Copper-ATPases, ATP7A and ATP7B: Role in Copper Homeostasis. Arch Biochem Biophys. 463, 149-167.

  26. Niciu, M. J., Ma, X. M., El Meskini, R., Ronnett, G. V., Mains, R. E., and Eipper, B. A. (2006) Developmental Changes in the Expression of ATP7A during a Critical Period in Postnatal Neurodevelopment. Neuroscience. 139, 947-964.

  27. Braiterman, L., Nyasae, L., Guo, Y., Bustos, R., Lutsenko, S., and Hubbard, A. (2009) Apical Targeting and Golgi Retention Signals Reside within a 9-Amino Acid Sequence in the Copper-ATPase, ATP7B. Am J Physiol Gastrointest Liver Physiol. 296, G433-44.

  28. Yang, X. L., Miura, N., Kawarada, Y., Terada, K., Petrukhin, K., Gilliam, T., and Sugiyama, T. (1997) Two Forms of Wilson Disease Protein Produced by Alternative Splicing are Localized in Distinct Cellular Compartments. Biochem J. 326 ( Pt 3), 897-902.

  29. Kim, H. W., Chan, Q., Afton, S. E., Caruso, J. A., Lai, B., Weintraub, N. L., and Qin, Z. (2012) Human Macrophage ATP7A is Localized in the Trans-Golgi Apparatus, Controls Intracellular Copper Levels, and Mediates Macrophage Responses to Dermal Wounds. Inflammation. 35, 167-175.

  30. Ashino, T., Sudhahar, V., Urao, N., Oshikawa, J., Chen, G. F., Wang, H., Huo, Y., Finney, L., Vogt, S., McKinney, R. D., Maryon, E. B., Kaplan, J. H., Ushio-Fukai, M., and Fukai, T. (2010) Unexpected Role of the Copper Transporter ATP7A in PDGF-Induced Vascular Smooth Muscle Cell Migration. Circ Res. 107, 787-799.

  31. Murata, Y., Yamakawa, E., Iizuka, T., Kodama, H., Abe, T., Seki, Y., and Kodama, M. (1995) Failure of Copper Incorporation into Ceruloplasmin in the Golgi Apparatus of LEC Rat Hepatocytes. Biochem Biophys Res Commun. 209, 349-355.

  32. Terada, K., Aiba, N., Yang, X. L., Iida, M., Nakai, M., Miura, N., and Sugiyama, T. (1999) Biliary Excretion of Copper in LEC Rat After Introduction of Copper Transporting P-Type ATPase, ATP7B. FEBS Lett. 448, 53-56.

  33. Guo, Y., Nyasae, L., Braiterman, L. T., and Hubbard, A. L. (2005) NH2-Terminal Signals in ATP7B Cu-ATPase Mediate its Cu-Dependent Anterograde Traffic in Polarized Hepatic Cells. Am J Physiol Gastrointest Liver Physiol. 289, G904-16.

  34. Bartee, M. Y., and Lutsenko, S. (2007) Hepatic Copper-Transporting ATPase ATP7B: Function and Inactivation at the Molecular and Cellular Level. Biometals. 20, 627-637.

  35. Roelofsen, H., Wolters, H., Van Luyn, M. J., Miura, N., Kuipers, F., and Vonk, R. J. (2000) Copper-Induced Apical Trafficking of ATP7B in Polarized Hepatoma Cells Provides a Mechanism for Biliary Copper Excretion. Gastroenterology. 119, 782-793.

  36. Hardman, B., Michalczyk, A., Greenough, M., Camakaris, J., Mercer, J., and Ackland, L. (2007) Distinct Functional Roles for the Menkes and Wilson Copper Translocating P-Type ATPases in Human Placental Cells. Cell Physiol Biochem. 20, 1073-1084.

  37. Qin, Z., Itoh, S., Jeney, V., Ushio-Fukai, M., and Fukai, T. (2006) Essential Role for the Menkes ATPase in Activation of Extracellular Superoxide Dismutase: Implication for Vascular Oxidative Stress. FASEB J. 20, 334-336.

  38. Buiakova, O. I., Xu, J., Lutsenko, S., Zeitlin, S., Das, K., Das, S., Ross, B. M., Mekios, C., Scheinberg, I. H., and Gilliam, T. C. (1999) Null Mutation of the Murine ATP7B (Wilson Disease) Gene Results in Intracellular Copper Accumulation and Late-Onset Hepatic Nodular Transformation. Hum Mol Genet. 8, 1665-1671.

  39. Wu, J., Forbes, J. R., Chen, H. S., and Cox, D. W. (1994) The LEC Rat has a Deletion in the Copper Transporting ATPase Gene Homologous to the Wilson Disease Gene. Nat Genet. 7, 541-545.

  40. Theophilos, M. B., Cox, D. W., and Mercer, J. F. (1996) The Toxic Milk Mouse is a Murine Model of Wilson Disease. Hum Mol Genet. 5, 1619-1624.

  41. Mori, M., Hattori, A., Sawaki, M., Tsuzuki, N., Sawada, N., Oyamada, M., Sugawara, N., and Enomoto, K. (1994) The LEC Rat: A Model for Human Hepatitis, Liver Cancer, and Much More. Am J Pathol. 144, 200-204.

  42. Okayasu, T., Tochimaru, H., Hyuga, T., Takahashi, T., Takekoshi, Y., Li, Y., Togashi, Y., Takeichi, N., Kasai, N., and Arashima, S. (1992) Inherited Copper Toxicity in Long-Evans Cinnamon Rats Exhibiting Spontaneous Hepatitis: A Model of Wilson's Disease. Pediatr Res. 31, 253-257.

  43. Yoshida, M. C., Masuda, R., Sasaki, M., Takeichi, N., Kobayashi, H., Dempo, K., and Mori, M. (1987) New Mutation Causing Hereditary Hepatitis in the Laboratory Rat. J Hered. 78, 361-365.

  44. Biempica, L., Rauch, H., Quintana, N., and Sternlieb, I. (1988) Morphologic and Chemical Studies on a Murine Mutation (Toxic Milk Mice) Resulting in Hepatic Copper Toxicosis. Lab Invest. 59, 500-508.

  45. Roberts, E. A., Robinson, B. H., and Yang, S. (2008) Mitochondrial Structure and Function in the Untreated Jackson Toxic Milk (Tx-j) Mouse, a Model for Wilson Disease. Mol Genet Metab. 93, 54-65.

  46. Rauch, H. (1983) Toxic Milk, a New Mutation Affecting Cooper Metabolism in the Mouse. J Hered. 74, 141-144.