Phenotypic Mutation 'wavy' (pdf version)
Allelewavy
Mutation Type missense
Chromosome2
Coordinate147,365,802 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Pax1
Gene Name paired box 1
Synonym(s) Pax-1, hunchback, wavy tail, hbs, wt
Chromosomal Location 147,361,925-147,393,295 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. This gene plays a role in pattern formation during embryogenesis and may be essential for development of the vertebral column. This gene is silenced by methylation in ovarian and cervical cancers and may be a tumor suppressor gene. Mutations in this gene are also associated with vertebral malformations. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for several mutations exhibit variably severe morphological alterations of vertebral column, sternum, scapula, skull, and thymus, with reduced adult survival and fertility. Some heterozygotes show milder skeletal abnormalities. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008780; MGI:97485

Mapped Yes 
Limits of the Critical Region 147361925 - 147393295 bp
Amino Acid Change Isoleucine changed to Asparagine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000105594] [ENSMUSP00000119667]
SMART Domains Protein: ENSMUSP00000105594
Gene: ENSMUSG00000037034
AA Change: I110N

DomainStartEndE-ValueType
low complexity region 9 55 N/A INTRINSIC
PAX 89 213 9.13e-91 SMART
low complexity region 380 394 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000109968)
SMART Domains Protein: ENSMUSP00000119667
Gene: ENSMUSG00000037034
AA Change: I198N

DomainStartEndE-ValueType
low complexity region 97 143 N/A INTRINSIC
PAX 177 301 9.13e-91 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000126068)
Meta Mutation Damage Score 0.75 question?
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (DSS Female) - decreased
limbs/digits/tail phenotype
Candidate Explorer Status CE: excellent candidate; human score: 0; ML prob: 0.458
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(12) : Spontaneous(5) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0030:Pax1 UTSW 2 147368582 missense probably damaging 0.99
R0147:Pax1 UTSW 2 147373734 missense probably benign 0.17
R0304:Pax1 UTSW 2 147366147 missense probably benign 0.20
R1544:Pax1 UTSW 2 147368401 missense probably damaging 0.99
R1583:Pax1 UTSW 2 147366255 missense possibly damaging 0.94
R1937:Pax1 UTSW 2 147367889 missense possibly damaging 0.78
R2143:Pax1 UTSW 2 147365882 missense probably damaging 1.00
R2208:Pax1 UTSW 2 147365802 missense probably damaging 1.00
R2915:Pax1 UTSW 2 147368428 missense probably damaging 1.00
R3878:Pax1 UTSW 2 147362308 unclassified probably benign
R4788:Pax1 UTSW 2 147366204 missense possibly damaging 0.94
R6323:Pax1 UTSW 2 147368401 missense probably damaging 1.00
R6842:Pax1 UTSW 2 147373720 missense probably benign 0.00
R7052:Pax1 UTSW 2 147365904 missense probably damaging 1.00
R7117:Pax1 UTSW 2 147366270 missense probably damaging 0.98
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038222-MU
Last Updated 2019-09-04 9:45 PM by Anne Murray
Record Created 2015-06-19 4:17 PM by Jin Huk Choi
Record Posted 2015-09-24
Phenotypic Description

Figure 1. Wavy mice have kinks in their tails.

The wavy phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2208, some of which showed exhibited kinked (or wavy) tails (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. Among these, only one affected a gene with known effects on pigmentation, Pax1. The mutation in Pax1 was presumed to be causative because the wavy kinked tail phenotype mimics other known alleles of Pax1 (see MGI for a list of Pax1 alleles). The Pax1 mutation is a T to A transversion at base pair 147,365,802 (v38) on chromosome 2, or base pair 3,878 in the GenBank genomic region NC_000068.

 

The mutation corresponds to residue 383 in the mRNA sequence NM_008780 within exon 2 of 5 total exons.

 

367 CCCCTGCCCAATGCCATCCGCCTACGAATCGTG

105 -P--L--P--N--A--I--R--L--R--I--V-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to asparagine (N) substitution at position 110 (I110N) in the paired box 1 (PAX1) protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000) (1).

Protein Prediction
Figure 2. PAX3 domain structure. PAX3 consists of a paired domain (PD) and an octapeptide (OCTA). The wavy mutation, designated by a red asterisk, results in an isoleucine (I) to asparagine (N) substitution at position 110 (I110N).

PAX1 is a member of the PAX family of transcription factors (2). The PAX proteins are subdivided into four groups: group 1 (PAX1 and PAX9), group 2 (PAX2, 5 (see the record for Apple), and 8), group 3 (PAX3 (see the record for Widget) and 7), and group 4 (PAX4 and 6). All PAX proteins have a paired domain (amino acids 89-215 in mouse PAX1) that mediates DNA binding (Figure 2). The paired domain has two helix-turn-helix motifs separated by a polypeptide linker. Unlike other members of the PAX family (e.g., PAX3 and PAX5), PAX1 and PAX9 do not have homeobox domains. In other PAX proteins, the homeodomain is an additional DNA-binding domain that can either act independently of the paired domain or together to bind target genes.

 

PAX1 also has a highly conserved octapeptide (amino acids 281-288); the function of the octapeptide in PAX1 is unknown. In PAX5, the octapeptide motif is required for Pax5-Groucho-mediated gene repression; mutation or deletion of this sequence leads to an increase in the transactivation of Pax proteins (3). Also, the octapeptide motif has the potential to direct cytosine methylation to surrounding gene sequences (4).

 

The wavy mutation results in an isoleucine (I) to asparagine (N) substitution at position 110 (I110N). I110 is within the paired domain.

Expression/Localization

Pax1 is expressed in the facial mesenchyme, limb buds, shoulder girdles, thymus, pharyngeal pouches, and sclerotome (5). Pax1 is expressed in sclerotomal cells as early as embryonic day (E) 8.5 (6;7), in pharyngeal pouches at E9.5 (8), in the anterior proximal region of the limb buds at E10.0 (9), and the developing sternum at E13.0 (6). Sonic hedgehog (Shh) and Noggin can induce Pax1 expression in the sclerotome (10-12). In the human, PAX1 is expressed in a segmented pattern in the developing spines of seven- to eight-week-old fetuses (13).

Background
Figure 3. The compartmented somite and sclerotome differentiation. Sonic Hedgehog (Shh) secreted by the notochord and the floor plate of the neural tube is a postive inducer of the sclerotome and its differentiation into cartilaginous tissu. Bone morphogenetic protein (BMP) signals from the lateral plate mesoderm and the roof plate of the neural tube antagonize Shh signals during early sclerotome formation, but cooperate later with Shh to promote chondrogenesis. PAX1 cooperates with PAX9 to induce Bapx1 expression, which induces axial skeleton development. The dermomyotome gives rise to the dermis and muscle.

The PAX protein family regulates pattern formation, morphogenesis, cellular differentiation, and organogenesis by activating (or repressing) genes that encode secreted proteins, cell surface receptors, cell cycle regulators, and transcription factors.

 

The axial skeleton (i.e., vertebral column, the sternum, and the scapula) originates from somites, paraxial mesoderm structures on either side of the neural tube and notochord (Figure 3). During embryonic axial skeleton development, somitogenesis is followed by either differentiation of the somites into mesenchymal sclerotome, or the somites remain epithelial to form the dermomyotome. Subsequently, the sclerotomal cells migrate and condense around the notochord, and they differentiate into vertebral bodies and intervertebral discs. PAX1 and PAX9 are essential for development of axial skeleton (13;14). PAX1 synergizes with PAX9 and MFH1 (mesenchyme forkhead 1) in the notochord to regulate sclerotomal cell proliferation [Figure 3; (10;14)].  In addition, PAX1 cooperates with HOXA5 (homeobox A5), a member of the HOX family of transcription factors, to mediate the vertebral patterning of the cervicothoracic transition and in acromion (i.e., lateral extension of the spine of the scapula) morphogenesis (15). PAX1 is an early regulator of the determination of prechondrogenic condensation, while HOXA5 is required for the correct specification of cell lineages during chondrogenesis. PAX1 and HOXA5 are necessary for the formation of vertebrae C6, T1, and T2 as well as the acromion in the pectoral girdle. PAX1 promotes the early stages of chondrogenic differentiation by transactivating the transcriptional repressor, Nk3 homeobox 2 (Nkx3.2) (16). Nkx3.2 blocks chondorocte hypertrophy through the repression of Runt-related transcription factor 2 (Runx2) in late Sox9 (SRY-box containing gene 9)-driven chondrogenic differentiation. Bapx1 expression is a downstream target of PAX1 and PAX9 (17). BAPX1 is expressed in the mesoderm and is essential for the formation of the visceral musculature (18).

 

Development of thymocytes into mature T cells occurs in the thymus, where thymocytes follow a program of differentiation characterized by expression of distinct combinations of cell surface proteins including CD4, CD8, CD44 and CD25. The most immature thymocytes are CD4-CD8- double negative (DN). This group can be further subdivided into 4 groups that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4). During this process, expression of pre-TCRα (pTα), TCRα, TCRβ and CD3 proteins is activated in temporal sequence to promote T cell development. The DN3 stage is the first critical checkpoint during thymocyte development. Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ. This complex is known as the pre-TCR and produces a TCR-like signal that is necessary for continued survival. After progressing through the DN4 stage, αβ thymocytes express both CD4 and CD8 and are known as double positive (DP) cells. Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain. PAX1 interacts with HOXA3 (homeobox A3), a member of the HOX family of transcription factors, to regulate the proliferation of epithelial cells of the thymus and parathyroid gland (19;20). Hoxa3+/−Pax1−/− mice exhibited more severe thymus defects than Pax1−/− mice (19). The Hoxa3+/−Pax1−/− mice had fewer MHC class II-positive epithelial cells. The thymic epithelial cells in the Hoxa3+/−Pax1−/− mice were defective in promoting thymocyte development, resulting in block in thymocyte maturation and a reduction in the number of CD4+8+ thymocytes with a concomitant increase in apoptosis of CD4+8+ and CD4425(CD348) cells (19).

 

Mutations in PAX1 have been linked to several conditions in humans including Klippel-Feil syndrome (21). Klippel-Feil syndrome is characterized by failed segmentation of the cervical vertebrae with a concomitant low posterior hairline and a shortened, immobile neck. PAX1 is also a candidate gene for the development of human vertebral malformations including butterfly vertebra, segmentation defect, or hemivertebra/hypoplasia (22). A mutation in PAX1 has been identified in a patient with spina bifida (23). A mutation in PAX1 has been linked to otofaciocervical syndrome (OMIM: #615560), a condition in which patients have facial dysmorphism, external ear anomalies, branchial cysts, vertebrae and shoulder girdle anomalies, and mild intellectual disability (24). Methylation of PAX1 has been identified as a biomarker for oral squamous cell carcinoma (25) and cervical intraepithelial neoplasia (26).

Putative Mechanism

Four Pax1 mutant mouse models, termed undulated, undulated extensive (unex), Undulated short-tail (UnS), and undulated intermediate (un-i) (27) exhibit size reductions and/or malformations of the vertebral column (7), the pectoral girdle (9), the sternum (28), and the thymus (8). The undulated (un) strain has a mutation in the paired domain, the undulated extensive (unex) strain has a deletion within the last exon of Pax1 (28), Undulated short-tail (UnS) has a deletion of the entire Pax1 locus (8), and undulated intermediate (un-i) does not have the 5’-flanking region and exon 1 to 4 (29). The UnS and un-i mice exhibited other skeletal abnormalities including a short and kinked tail (7;29). Undulated mice have short and kinky tails due to irregularly shaped vertebrae and intervertebral discs. The UnS mice exhibit perinatal lethality. In the undulated mice, thymus hypoplasia and changes in thymocyte maturation were also observed (8;29). A Pax1 knockout mouse was phenotypically similar to the un and unwe mice (30). Mutation of Pax1 in the wavy mice may be leading to perturbed association with downstream targets necessary for axial skeletal development.

Primers PCR Primer
wavy(F):5'- TAGATCTGAGATGTCGGAGGC -3'
wavy(R):5'- ATGTGCTTCACTACATTGGGG -3'

Sequencing Primer
wavy_seq(F):5'- ACCTGCGGGTTATCTCAGAGTC -3'
wavy_seq(R):5'- CACTACATTGGGGGTGGTAACTC -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 405 nucleotides is amplified (chromosome 2, + strand):


1   tagatctgag atgtcggagg ctggggtgga cctgcgggtt atctcagagt cgcgctaggg
61  tgcagtgcat tggttcccca aggacaccct tgagtaaccc gccggtgttt tctccctcgc
121 ctgctcactc ctatccggcg cgtctgcaga gcagacgtac ggcgaagtga accaacttgg
181 tggcgtgttc gtcaacggcc gtcccctgcc caatgccatc cgcctacgaa tcgtggagct
241 agcacagctg ggtatccgac cctgtgacat cagtaggcaa ctgcgggtct ctcatggctg
301 cgtgagcaaa atcctggcgc gctacaacga gaccggctcc atcctgcccg gggccatcgg
361 gggcagcaaa cctcgagtta ccacccccaa tgtagtgaag cacat


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJin Huk Choi, Kuan-wen Wang, Emre Turer, Bruce Beutler