Phenotypic Mutation 'wavy'

• Allele: wavy
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 147,207,722 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Pax1
• Gene Name: paired box 1
• Synonym(s): hunchback, wavy tail, hbs, wt, Pax-1
• Chromosomal Location: 147,203,850-147,216,972 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. This gene plays a role in pattern formation during embryogenesis and may be essential for development of the vertebral column. This gene is silenced by methylation in ovarian and cervical cancers and may be a tumor suppressor gene. Mutations in this gene are also associated with vertebral malformations. [provided by RefSeq, Mar 2012] ; PHENOTYPE: Homozygotes for several mutations exhibit variably severe morphological alterations of vertebral column, sternum, scapula, skull, and thymus, with reduced adult survival and fertility. Some heterozygotes show milder skeletal abnormalities. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 147361925 - 147393295 bp
• Amino Acid Change: Isoleucine changed to Asparagine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000105594] [ENSMUSP00000119667]
• AlphaFold: P09084
• SMART Domains: Protein: ENSMUSP00000105594; Gene: ENSMUSG00000037034; AA Change: I110N

Domain	Start	End	E-Value	Type
low complexity region	9	55	N/A	INTRINSIC
PAX	89	213	9.13e-91	SMART
low complexity region	380	394	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000109968)
• SMART Domains: Protein: ENSMUSP00000119667; Gene: ENSMUSG00000037034; AA Change: I198N

Domain	Start	End	E-Value	Type
low complexity region	97	143	N/A	INTRINSIC
PAX	177	301	9.13e-91	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000126068)
• Meta Mutation Damage Score: 0.9352
• Is this an essential gene?: Possibly essential (E-score: 0.644)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• MMRRC Submission: 038222-MU
• Last Updated: 2019-09-04 9:45 PM by Anne Murray
• Record Created: 2015-06-19 4:17 PM by Jin Huk Choi
• Record Posted: 2015-09-24
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jin Huk Choi, Kuan-wen Wang, Emre Turer, Bruce Beutler

Accession Number

NCBI RefSeq: NM_008780; MGI:97485

Alleles Listed at MGI

All mutations/alleles(12) : Spontaneous(5) Targeted(7)

Phenotypic Description

Figure 1. Wavy mice have kinks in their tails.

The wavy phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2208, some of which showed exhibited kinked (or wavy) tails (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. Among these, only one affected a gene with known effects on pigmentation, Pax1. The mutation in Pax1 was presumed to be causative because the wavy kinked tail phenotype mimics other known alleles of Pax1 (see MGI for a list of Pax1 alleles). The Pax1 mutation is a T to A transversion at base pair 147,365,802 (v38) on chromosome 2, or base pair 3,878 in the GenBank genomic region NC_000068.

The mutation corresponds to residue 383 in the mRNA sequence NM_008780 within exon 2 of 5 total exons.

367 CCCCTGCCCAATGCCATCCGCCTACGAATCGTG 105 -P--L--P--N--A--I--R--L--R--I--V-

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to asparagine (N) substitution at position 110 (I110N) in the paired box 1 (PAX1) protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000) (1).

Protein Prediction

Figure 2. PAX3 domain structure. PAX3 consists of a paired domain (PD) and an octapeptide (OCTA). The wavy mutation, designated by a red asterisk, results in an isoleucine (I) to asparagine (N) substitution at position 110 (I110N).

PAX1 is a member of the PAX family of transcription factors (2). The PAX proteins are subdivided into four groups: group 1 (PAX1 and PAX9), group 2 (PAX2, 5 (see the record for Apple), and 8), group 3 (PAX3 (see the record for Widget) and 7), and group 4 (PAX4 and 6). All PAX proteins have a paired domain (amino acids 89-215 in mouse PAX1) that mediates DNA binding (Figure 2). The paired domain has two helix-turn-helix motifs separated by a polypeptide linker. Unlike other members of the PAX family (e.g., PAX3 and PAX5), PAX1 and PAX9 do not have homeobox domains. In other PAX proteins, the homeodomain is an additional DNA-binding domain that can either act independently of the paired domain or together to bind target genes.

PAX1 also has a highly conserved octapeptide (amino acids 281-288); the function of the octapeptide in PAX1 is unknown. In PAX5, the octapeptide motif is required for Pax5-Groucho-mediated gene repression; mutation or deletion of this sequence leads to an increase in the transactivation of Pax proteins (3). Also, the octapeptide motif has the potential to direct cytosine methylation to surrounding gene sequences (4).

The wavy mutation results in an isoleucine (I) to asparagine (N) substitution at position 110 (I110N). I110 is within the paired domain.

Expression/Localization

Pax1 is expressed in the facial mesenchyme, limb buds, shoulder girdles, thymus, pharyngeal pouches, and sclerotome (5). Pax1 is expressed in sclerotomal cells as early as embryonic day (E) 8.5 (6;7), in pharyngeal pouches at E9.5 (8), in the anterior proximal region of the limb buds at E10.0 (9), and the developing sternum at E13.0 (6). Sonic hedgehog (Shh) and Noggin can induce Pax1 expression in the sclerotome (10-12). In the human, PAX1 is expressed in a segmented pattern in the developing spines of seven- to eight-week-old fetuses (13).

Background

Figure 3. The compartmented somite and sclerotome differentiation. Sonic Hedgehog (Shh) secreted by the notochord and the floor plate of the neural tube is a postive inducer of the sclerotome and its differentiation into cartilaginous tissu. Bone morphogenetic protein (BMP) signals from the lateral plate mesoderm and the roof plate of the neural tube antagonize Shh signals during early sclerotome formation, but cooperate later with Shh to promote chondrogenesis. PAX1 cooperates with PAX9 to induce Bapx1 expression, which induces axial skeleton development. The dermomyotome gives rise to the dermis and muscle.

The PAX protein family regulates pattern formation, morphogenesis, cellular differentiation, and organogenesis by activating (or repressing) genes that encode secreted proteins, cell surface receptors, cell cycle regulators, and transcription factors.

The axial skeleton (i.e., vertebral column, the sternum, and the scapula) originates from somites, paraxial mesoderm structures on either side of the neural tube and notochord (Figure 3). During embryonic axial skeleton development, somitogenesis is followed by either differentiation of the somites into mesenchymal sclerotome, or the somites remain epithelial to form the dermomyotome. Subsequently, the sclerotomal cells migrate and condense around the notochord, and they differentiate into vertebral bodies and intervertebral discs. PAX1 and PAX9 are essential for development of axial skeleton (13;14). PAX1 synergizes with PAX9 and MFH1 (mesenchyme forkhead 1) in the notochord to regulate sclerotomal cell proliferation [Figure 3; (10;14)].  In addition, PAX1 cooperates with HOXA5 (homeobox A5), a member of the HOX family of transcription factors, to mediate the vertebral patterning of the cervicothoracic transition and in acromion (i.e., lateral extension of the spine of the scapula) morphogenesis (15). PAX1 is an early regulator of the determination of prechondrogenic condensation, while HOXA5 is required for the correct specification of cell lineages during chondrogenesis. PAX1 and HOXA5 are necessary for the formation of vertebrae C6, T1, and T2 as well as the acromion in the pectoral girdle. PAX1 promotes the early stages of chondrogenic differentiation by transactivating the transcriptional repressor, Nk3 homeobox 2 (Nkx3.2) (16). Nkx3.2 blocks chondorocte hypertrophy through the repression of Runt-related transcription factor 2 (Runx2) in late Sox9 (SRY-box containing gene 9)-driven chondrogenic differentiation. Bapx1 expression is a downstream target of PAX1 and PAX9 (17). BAPX1 is expressed in the mesoderm and is essential for the formation of the visceral musculature (18).

Development of thymocytes into mature T cells occurs in the thymus, where thymocytes follow a program of differentiation characterized by expression of distinct combinations of cell surface proteins including CD4, CD8, CD44 and CD25. The most immature thymocytes are CD4^-CD8^- double negative (DN). This group can be further subdivided into 4 groups that differentiate in the following order: CD44⁺CD25^- (DN1) to CD44⁺CD25⁺ (DN2) to CD44^-CD25⁺ (DN3) to CD44^-CD25^- (DN4). During this process, expression of pre-TCRα (pTα), TCRα, TCRβ and CD3 proteins is activated in temporal sequence to promote T cell development. The DN3 stage is the first critical checkpoint during thymocyte development. Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ. This complex is known as the pre-TCR and produces a TCR-like signal that is necessary for continued survival. After progressing through the DN4 stage, αβ thymocytes express both CD4 and CD8 and are known as double positive (DP) cells. Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain. PAX1 interacts with HOXA3 (homeobox A3), a member of the HOX family of transcription factors, to regulate the proliferation of epithelial cells of the thymus and parathyroid gland (19;20). Hoxa3^+/−Pax1^−/− mice exhibited more severe thymus defects than Pax1^−/− mice (19). The Hoxa3^+/−Pax1^−/− mice had fewer MHC class II-positive epithelial cells. The thymic epithelial cells in the Hoxa3^+/−Pax1^−/− mice were defective in promoting thymocyte development, resulting in block in thymocyte maturation and a reduction in the number of CD4⁺8⁺ thymocytes with a concomitant increase in apoptosis of CD4⁺8⁺ and CD44⁻25⁻(CD3⁻4⁻8⁻) cells (19).

Mutations in PAX1 have been linked to several conditions in humans including Klippel-Feil syndrome (21). Klippel-Feil syndrome is characterized by failed segmentation of the cervical vertebrae with a concomitant low posterior hairline and a shortened, immobile neck. PAX1 is also a candidate gene for the development of human vertebral malformations including butterfly vertebra, segmentation defect, or hemivertebra/hypoplasia (22). A mutation in PAX1 has been identified in a patient with spina bifida (23). A mutation in PAX1 has been linked to otofaciocervical syndrome (OMIM: #615560), a condition in which patients have facial dysmorphism, external ear anomalies, branchial cysts, vertebrae and shoulder girdle anomalies, and mild intellectual disability (24). Methylation of PAX1 has been identified as a biomarker for oral squamous cell carcinoma (25) and cervical intraepithelial neoplasia (26).

Putative Mechanism

Four Pax1 mutant mouse models, termed undulated, undulated extensive (un^ex), Undulated short-tail (Un^S), and undulated intermediate (un-i) (27) exhibit size reductions and/or malformations of the vertebral column (7), the pectoral girdle (9), the sternum (28), and the thymus (8). The undulated (un) strain has a mutation in the paired domain, the undulated extensive (un^ex) strain has a deletion within the last exon of Pax1 (28), Undulated short-tail (Un^S) has a deletion of the entire Pax1 locus (8), and undulated intermediate (un-i) does not have the 5’-flanking region and exon 1 to 4 (29). The Un^S and un-i mice exhibited other skeletal abnormalities including a short and kinked tail (7;29). Undulated mice have short and kinky tails due to irregularly shaped vertebrae and intervertebral discs. The Un^S mice exhibit perinatal lethality. In the undulated mice, thymus hypoplasia and changes in thymocyte maturation were also observed (8;29). A Pax1 knockout mouse was phenotypically similar to the un and un^we mice (30). Mutation of Pax1 in the wavy mice may be leading to perturbed association with downstream targets necessary for axial skeletal development.

Primers

PCR Primer
wavy_pcr_F: TAGATCTGAGATGTCGGAGGC
wavy_pcr_R: ATGTGCTTCACTACATTGGGG

Sequencing Primer
wavy_seq_F: ACCTGCGGGTTATCTCAGAGTC
wavy_seq_R: CACTACATTGGGGGTGGTAACTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 405 nucleotides is amplified (chromosome 2, + strand):

1   tagatctgag atgtcggagg ctggggtgga cctgcgggtt atctcagagt cgcgctaggg
61  tgcagtgcat tggttcccca aggacaccct tgagtaaccc gccggtgttt tctccctcgc
121 ctgctcactc ctatccggcg cgtctgcaga gcagacgtac ggcgaagtga accaacttgg
181 tggcgtgttc gtcaacggcc gtcccctgcc caatgccatc cgcctacgaa tcgtggagct
241 agcacagctg ggtatccgac cctgtgacat cagtaggcaa ctgcgggtct ctcatggctg
301 cgtgagcaaa atcctggcgc gctacaacga gaccggctcc atcctgcccg gggccatcgg
361 gggcagcaaa cctcgagtta ccacccccaa tgtagtgaag cacat

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Schafer, B. W. (1998) Emerging Roles for PAX Transcription Factors in Cancer Biology. Gen Physiol Biophys. 17, 211-224.

  3. Noll, M. (1993) Evolution and Role of Pax Genes. Curr Opin Genet Dev. 3, 595-605.

  4. Ziman, M. R., and Kay, P. H. (1998) A Conserved TN8TCCT Motif in the Octapeptide-Encoding Region of Pax Genes which has the Potential to Direct Cytosine Methylation. Gene. 223, 303-308.

  5. Koseki, H., Wallin, J., Wilting, J., Mizutani, Y., Kispert, A., Ebensperger, C., Herrmann, B. G., Christ, B., and Balling, R. (1993) A Role for Pax-1 as a Mediator of Notochordal Signals during the Dorsoventral Specification of Vertebrae. Development. 119, 649-660.

  6. Deutsch, U., Dressler, G. R., and Gruss, P. (1988) Pax 1, a Member of a Paired Box Homologous Murine Gene Family, is Expressed in Segmented Structures during Development. Cell. 53, 617-625.

  7. Wallin, J., Wilting, J., Koseki, H., Fritsch, R., Christ, B., and Balling, R. (1994) The Role of Pax-1 in Axial Skeleton Development. Development. 120, 1109-1121.

  8. Wallin, J., Eibel, H., Neubuser, A., Wilting, J., Koseki, H., and Balling, R. (1996) Pax1 is Expressed during Development of the Thymus Epithelium and is Required for Normal T-Cell Maturation. Development. 122, 23-30.

  9. Timmons, P. M., Wallin, J., Rigby, P. W., and Balling, R. (1994) Expression and Function of Pax 1 during Development of the Pectoral Girdle. Development. 120, 2773-2785.

  10. Furumoto, T. A., Miura, N., Akasaka, T., Mizutani-Koseki, Y., Sudo, H., Fukuda, K., Maekawa, M., Yuasa, S., Fu, Y., Moriya, H., Taniguchi, M., Imai, K., Dahl, E., Balling, R., Pavlova, M., Gossler, A., and Koseki, H. (1999) Notochord-Dependent Expression of MFH1 and PAX1 Cooperates to Maintain the Proliferation of Sclerotome Cells during the Vertebral Column Development. Dev Biol. 210, 15-29.

  11. Fan, C. M., and Tessier-Lavigne, M. (1994) Patterning of Mammalian Somites by Surface Ectoderm and Notochord: Evidence for Sclerotome Induction by a Hedgehog Homolog. Cell. 79, 1175-1186.

  12. McMahon, J. A., Takada, S., Zimmerman, L. B., Fan, C. M., Harland, R. M., and McMahon, A. P. (1998) Noggin-Mediated Antagonism of BMP Signaling is Required for Growth and Patterning of the Neural Tube and Somite. Genes Dev. 12, 1438-1452.

  13. Smith, C. A., and Tuan, R. S. (1994) Human PAX Gene Expression and Development of the Vertebral Column. Clin Orthop Relat Res. (302), 241-250.

  14. Peters, H., Wilm, B., Sakai, N., Imai, K., Maas, R., and Balling, R. (1999) Pax1 and Pax9 Synergistically Regulate Vertebral Column Development. Development. 126, 5399-5408.

  15. Aubin, J., Lemieux, M., Moreau, J., Lapointe, J., and Jeannotte, L. (2002) Cooperation of Hoxa5 and Pax1 Genes during Formation of the Pectoral Girdle. Dev Biol. 244, 96-113.

  16. Takimoto, A., Mohri, H., Kokubu, C., Hiraki, Y., and Shukunami, C. (2013) Pax1 Acts as a Negative Regulator of Chondrocyte Maturation. Exp Cell Res. 319, 3128-3139.

  17. Rodrigo, I., Hill, R. E., Balling, R., Munsterberg, A., and Imai, K. (2003) Pax1 and Pax9 Activate Bapx1 to Induce Chondrogenic Differentiation in the Sclerotome. Development. 130, 473-482.

  18. Azpiazu, N., and Frasch, M. (1993) Tinman and Bagpipe: Two Homeo Box Genes that Determine Cell Fates in the Dorsal Mesoderm of Drosophila. Genes Dev. 7, 1325-1340.

  19. Su, D. M., and Manley, N. R. (2000) Hoxa3 and pax1 Transcription Factors Regulate the Ability of Fetal Thymic Epithelial Cells to Promote Thymocyte Development. J Immunol. 164, 5753-5760.

  20. Su, D., Ellis, S., Napier, A., Lee, K., and Manley, N. R. (2001) Hoxa3 and pax1 Regulate Epithelial Cell Death and Proliferation during Thymus and Parathyroid Organogenesis. Dev Biol. 236, 316-329.

  21. McGaughran, J. M., Oates, A., Donnai, D., Read, A. P., and Tassabehji, M. (2003) Mutations in PAX1 may be Associated with Klippel-Feil Syndrome. Eur J Hum Genet. 11, 468-474.

  22. Giampietro, P. F., Raggio, C. L., Reynolds, C. E., Shukla, S. K., McPherson, E., Ghebranious, N., Jacobsen, F. S., Kumar, V., Faciszewski, T., Pauli, R. M., Rasmussen, K., Burmester, J. K., Zaleski, C., Merchant, S., David, D., Weber, J. L., Glurich, I., and Blank, R. D. (2005) An Analysis of PAX1 in the Development of Vertebral Malformations. Clin Genet. 68, 448-453.

  23. Hol, F. A., Geurds, M. P., Chatkupt, S., Shugart, Y. Y., Balling, R., Schrander-Stumpel, C. T., Johnson, W. G., Hamel, B. C., and Mariman, E. C. (1996) PAX Genes and Human Neural Tube Defects: An Amino Acid Substitution in PAX1 in a Patient with Spina Bifida. J Med Genet. 33, 655-660.

  24. Pohl, E., Aykut, A., Beleggia, F., Karaca, E., Durmaz, B., Keupp, K., Arslan, E., Palamar, M., Yigit, G., Ozkinay, F., and Wollnik, B. (2013) A Hypofunctional PAX1 Mutation Causes Autosomal Recessively Inherited Otofaciocervical Syndrome. Hum Genet. 132, 1311-1320.

  25. Huang, Y. K., Peng, B. Y., Wu, C. Y., Su, C. T., Wang, H. C., and Lai, H. C. (2014) DNA Methylation of PAX1 as a Biomarker for Oral Squamous Cell Carcinoma. Clin Oral Investig. 18, 801-808.

  26. Kan, Y. Y., Liou, Y. L., Wang, H. J., Chen, C. Y., Sung, L. C., Chang, C. F., and Liao, C. I. (2014) PAX1 Methylation as a Potential Biomarker for Cervical Cancer Screening. Int J Gynecol Cancer. 24, 928-934.

  27. Balling, R., Deutsch, U., and Gruss, P. (1988) Undulated, a Mutation Affecting the Development of the Mouse Skeleton, has a Point Mutation in the Paired Box of Pax 1. Cell. 55, 531-535.

  28. Dietrich, S., and Gruss, P. (1995) Undulated Phenotypes Suggest a Role of Pax-1 for the Development of Vertebral and Extravertebral Structures. Dev Biol. 167, 529-548.

  29. Adham, I. M., Gille, M., Gamel, A. J., Reis, A., Dressel, R., Steding, G., Brand-Saberi, B., and Engel, W. (2005) The Scoliosis (Sco) Mouse: A New Allele of Pax1. Cytogenet Genome Res. 111, 16-26.

  30. Wilm, B., Dahl, E., Peters, H., Balling, R., and Imai, K. (1998) Targeted Disruption of Pax1 Defines its Null Phenotype and Proves Haploinsufficiency. Proc Natl Acad Sci U S A. 95, 8692-8697.