Phenotypic Mutation 'riogrande2'

• Allele: riogrande2
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 161,614,707 bp (GRCm39)
• Base Change: T ⇒ G (forward strand)
• Gene: Fasl
• Gene Name: Fas ligand
• Synonym(s): Fasl, CD95L, APT1LG1, Tnfsf6, Fas-L, CD178
• Chromosomal Location: 161,608,260-161,616,064 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014] ; PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000000834] [ENSMUSP00000141422]
• AlphaFold: P41047
• SMART Domains: Protein: ENSMUSP00000000834; Gene: ENSMUSG00000000817; AA Change: S119R

Domain	Start	End	E-Value	Type
low complexity region	45	70	N/A	INTRINSIC
transmembrane domain	78	100	N/A	INTRINSIC
TNF	143	279	2.29e-54	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
  (Using ENSMUST00000000834)
• SMART Domains: Protein: ENSMUSP00000141422; Gene: ENSMUSG00000000817

Domain	Start	End	E-Value	Type
Pfam:TNF	1	69	2.3e-15	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.0898
• Is this an essential gene?: Possibly nonessential (E-score: 0.418)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• MMRRC Submission: 038208-MU
• Last Updated: 2019-09-04 9:45 PM by Anne Murray
• Record Created: 2015-06-30 9:04 PM by Kuan-Wen Wang
• Record Posted: 2015-08-05
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Kuan-Wen Wang, Jin Huk Choi, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010177, NM_001205243; MGI:99255

Alleles Listed at MGI

All mutations/alleles(15) : Chemically induced (ENU)(1) Spontaneous(2) Targeted(10) Transgenic(2)

Phenotypic Description

Figure 1. Homozygous riogrande2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The riogrande2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2167, some of which showed exhibited diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent IgG responses to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R2167. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The diminished T-dependent antibody response to rSFV-β-gal was linked by continuous variable mapping to a mutation in Fasl:  an A to C transversion at base pair 161,787,138 (v38) on chromosome 1, or base pair 8,401 in the GenBank genomic region NC_000067.  Linkage was found with a recessive model of inheritance (P = 2.666 x 10^-6), wherein 1 variant homozygote departed phenotypically from 4 homozygous reference mice and 9 heterozygous mice (Figure 2).  

The mutation corresponds to residue 565 in the mRNA sequence NM_010177 within exon 2 of 4 total exons.

550 GAGTTCACCAACCAAAGCCTTAAAGTATCATCT 114 -E--F--T--N--Q--S--L--K--V--S--S-

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to arginine (R) substitution at position 119 (S119R) in the FasL protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.001) (1).

Protein Prediction

Figure 3. Domain structure of FasL. The riogrande2 mutation results in a serine (S) to arginine (R) substitution at position 119 (S119R). The sites of SSPL2a and ADAM10/MMP3/MMP7 cleavage are shown. See the text for more details. Abbreviations: PRD, proline-rich domain; Poly-Pro, polyproline domain; TM, transmembrane domain; SA, self-assembly region; THD, tumor necrosis factor homology domain; ICD, intracellular domain. This image is interactive. Click on the image to view other mutations found in FasL. Click on each mutation for more specific information.

Fasl encodes Fas ligand (FasL; alternatively, CD95L, TNFSF6, or CD178), a type II membrane protein and member of the tumor necrosis factor (TNF; see the record for Dome) family [reviewed in (2;3)]. The 279 amino acid mouse FasL consists of an intracellular domain (ICD; amino acids 1-78), a transmembrane domain (amino acids 79-100), and an extracellular TNF homology domain (THD; amino acids 101-279) that contains the Fas (see the record for cherry) receptor-binding site [Figure 3; (4); reviewed in (2)]. A proline-rich domain (PRD) and polyproline domain within the ICD (amino acids 4-69 and 45-51, respectively) facilitate the binding of Src homology 3 (SH3) or WW domain-containing proteins (e.g., Fyn, Nck, SNX9, SNX18, SNX33, and CD2BP1) to FasL [(5); reviewed in (2;3)].

FasL occurs in both a membrane-bound (mFasL) and soluble form (sFasL) as a result of proteolytic processing of FasL. A disintegrin and metallopeptidase domain 10 (ADAM10; for information about ADAM family member, Adam17, please see the record wavedX) cleaves FasL between Lys127 and Gln128. Following cleavage by ADAM10, FasL is further processed by signal peptide peptidase-like 2a (SPPL2a; amino acids 79-80). Metalloproteinase-3 (MMP3) and MMP7 (see the record cartoon for information about MMP family member Mmp14) have also been linked to the cleavage of FasL between Lys127 and Gln128 in some cells (e.g., glandular epithelial cells) (6).

The riogrande2 mutation results in a serine to arginine substitution at position 119 (S119R) within the THD domain.

Please see the record riogrande for more information about Fasl.

Putative Mechanism

The FasL/Fas receptor system has several functions: (i) acting as a pro-apoptotic factor, (ii) facilitating the removal of target cells by NK and cytotoxic T lymphocytes (CTLs), (iii) maintaining immune-privileged sites, (iv) preventing autoimmunity, (v) regulating resting T cell activation by acting as a non-apoptotic costimulatory ligand/receptor, (vi) acting as a proinflammatory signal, (vii) acting as a proliferative/promigratory signal, and (viii) assisting in tumor cell survival [reviewed in (2;7)]. Loss of Fasl expression results in leukocytosis, splenomegaly, enlarged peripheral lymph nodes, and premature death by 4-5 months (8-10). Mutations in FASL are linked to autoimmune lymphoproliferative syndrome, type IB (ALPS; OMIM: #601859) (11). In ALPS, patients exhibit nonmalignant lymphadenopathy with splenomegaly (12). ALPS is an autosomal dominant disorder of FasL-induced apoptosis, resulting in the accumulation of autoreactive lymphocytes and the production of autoantibodies (13). Patients with ALPS may also exhibit includes Coombs-positive hemolytic anemia, chronic immune thrombocytopenic purpura, and neutropenia (12).

In both B and T cell development, apoptosis is essential to maintain immune cell homeostasis. Immature cells that fail to undergo proper V(D)J rearrangement and subsequently fail to express surface antigen receptors (BCR or TCR) undergo apoptosis. Fas/FasL-induced apoptosis is essential for the deletion of autoreactive thymocytes and immature B cells in the bone marrow [(14;15); reviewed in (16)]. Homozygous Fasl ΔIntra mice, a knockin model that expresses a FasL protein that lacks the ICD but expresses a functional, truncated mFasL, exhibited elevated plasma cells and increased generation of germinal center B cells, leading to increased titers of NP-specific IgM antibodies in the serum after immunization with 3-hydroxy 4-nitrophenylacetyl chicken gamma globulin (NP-CGG) (17). T-independent immunization of homozygous Fasl ΔIntra mice with NP-Ficoll resulted in increased plasma cell number as well as NP-specific IgM titers (17). In addition, the Fasl^-/- and Fasl^del mice exhibited increased IgG and IgM levels compared to wild-type levels (8;10). The riogrande2 mice exhibit reduced T-dependent IgG responses to rSFV, indicating that the activation of B and/or T cells in the riogrande2 mice may be negatively affected by the Fasl mutation.

Primers

PCR Primer
riogrande2_pcr_F: GTCAAAAGCTCCTCAGGGTTTC
riogrande2_pcr_R: CCTCTCTGAGTTGTCAAGGGTG

Sequencing Primer
riogrande2_seq_F: CCTCAGGGTTTCATGCCTAGG
riogrande2_seq_R: CGCTGCTTCATGTTTAGTGATTCAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 466 nucleotides is amplified (chromosome 1, - strand):

1   cctctctgag ttgtcaaggg tgtttgatga gcttctcgct gcttcatgtt tagtgattca
61  aggatgaaaa tcaattttgt gtcttgttca gaagtgtaaa taaattaatt ttcttcaaag
121 agacttagaa gtcttactac tactctagat acaattgtgt ggctaaaccc taactcgggc
181 caggtctgac atatctgagt cctctttcta tggattgctg tgacttctgc ttccttggct
241 taaataactg cacatttatt ctatgactct ctttctctca ctagttcacc aaccaaagcc
301 ttaaagtatc atcttttgaa aagcaaatag gtaagtactt ttatgtctgc cttgtgagtt
361 cccatagctg gtcttcaaca ctcaataaag ttgggaggat gcctaggatt ctgtgccttt
421 cttgggctta tgtttcctag gcatgaaacc ctgaggagct tttgac

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Lettau, M., Paulsen, M., Schmidt, H., and Janssen, O. (2011) Insights into the Molecular Regulation of FasL (CD178) Biology. Eur J Cell Biol. 90, 456-466.

  3. Ehrenschwender, M., and Wajant, H. (2009) The Role of FasL and Fas in Health and Disease. Adv Exp Med Biol. 647, 64-93.

  4. Suda, T., Takahashi, T., Golstein, P., and Nagata, S. (1993) Molecular Cloning and Expression of the Fas Ligand, a Novel Member of the Tumor Necrosis Factor Family. Cell. 75, 1169-1178.

  5. Ghadimi, M. P., Sanzenbacher, R., Thiede, B., Wenzel, J., Jing, Q., Plomann, M., Borkhardt, A., Kabelitz, D., and Janssen, O. (2002) Identification of Interaction Partners of the Cytosolic Polyproline Region of CD95 Ligand (CD178). FEBS Lett. 519, 50-58.

  6. Tanaka, M., Itai, T., Adachi, M., and Nagata, S. (1998) Downregulation of Fas Ligand by Shedding. Nat Med. 4, 31-36.

  7. Walczak, H. (2013) Death Receptor-Ligand Systems in Cancer, Cell Death, and Inflammation. Cold Spring Harb Perspect Biol. 5, a008698.

  8. Karray, S., Kress, C., Cuvellier, S., Hue-Beauvais, C., Damotte, D., Babinet, C., and Levi-Strauss, M. (2004) Complete Loss of Fas Ligand Gene Causes Massive Lymphoproliferation and Early Death, Indicating a Residual Activity of Gld Allele. J Immunol. 172, 2118-2125.

  9. Roths, J. B., Murphy, E. D., and Eicher, E. M. (1984) A New Mutation, Gld, that Produces Lymphoproliferation and Autoimmunity in C3H/HeJ Mice. J Exp Med. 159, 1-20.

  10. Wang, C. C., Zeng, Q., Hwang, L. A., Guo, K., Li, J., Liew, H. C., and Hong, W. (2006) Mouse Lymphomas Caused by an Intron-Splicing Donor Site Deletion of the FasL Gene. Biochem Biophys Res Commun. 349, 50-58.

  11. Del-Rey, M., Ruiz-Contreras, J., Bosque, A., Calleja, S., Gomez-Rial, J., Roldan, E., Morales, P., Serrano, A., Anel, A., Paz-Artal, E., and Allende, L. M. (2006) A Homozygous Fas Ligand Gene Mutation in a Patient Causes a New Type of Autoimmune Lymphoproliferative Syndrome. Blood. 108, 1306-1312.

  12. Randhawa, S. R., Chahine, B. G., Lowery-Nordberg, M., Cotelingam, J. D., and Casillas, A. M. (2010) Underexpression and Overexpression of Fas and Fas Ligand: A Double-Edged Sword. Ann Allergy Asthma Immunol. 104, 286-292.

  13. Canale, V. C., and Smith, C. H. (1967) Chronic Lymphadenopathy Simulating Malignant Lymphoma. J Pediatr. 70, 891-899.

  14. Rubio, C. F., Kench, J., Russell, D. M., Yawger, R., and Nemazee, D. (1996) Analysis of Central B Cell Tolerance in Autoimmune-Prone MRL/lpr Mice Bearing Autoantibody Transgenes. J Immunol. 157, 65-71.

  15. Singer, G. G., and Abbas, A. K. (1994) The Fas Antigen is Involved in Peripheral but Not Thymic Deletion of T Lymphocytes in T Cell Receptor Transgenic Mice. Immunity. 1, 365-371.

  16. Strasser, A., Jost, P. J., and Nagata, S. (2009) The Many Roles of FAS Receptor Signaling in the Immune System. Immunity. 30, 180-192.

  17. Luckerath, K., Kirkin, V., Melzer, I. M., Thalheimer, F. B., Siele, D., Milani, W., Adler, T., Aguilar-Pimentel, A., Horsch, M., Michel, G., Beckers, J., Busch, D. H., Ollert, M., Gailus-Durner, V., Fuchs, H., Hrabe de Angelis, M., Staal, F. J., Rajalingam, K., Hueber, A. O., Strobl, L. J., Zimber-Strobl, U., and Zornig, M. (2011) Immune Modulation by Fas Ligand Reverse Signaling: Lymphocyte Proliferation is Attenuated by the Intracellular Fas Ligand Domain. Blood. 117, 519-529.