Phenotypic Mutation 'riogrande2' (pdf version)
List |< first << previous [record 16 of 17] next >> last >|
Alleleriogrande2
Mutation Type missense
Chromosome1
Coordinate161,787,138 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Fasl
Gene Name Fas ligand (TNF superfamily, member 6)
Synonym(s) APT1LG1, CD178, CD95L, Fas-L, Tnfsf6
Chromosomal Location 161,780,689-161,788,495 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010177, NM_001205243; MGI:99255

Mapped Yes 
Amino Acid Change Serine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000000834] [ENSMUSP00000141422]
SMART Domains Protein: ENSMUSP00000000834
Gene: ENSMUSG00000000817
AA Change: S119R

DomainStartEndE-ValueType
low complexity region 45 70 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
TNF 143 279 2.29e-54 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
(Using ENSMUST00000000834)
SMART Domains Protein: ENSMUSP00000141422
Gene: ENSMUSG00000000817

DomainStartEndE-ValueType
Pfam:TNF 1 69 2.3e-15 PFAM
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All mutations/alleles(15) : Chemically induced (ENU)(1) Spontaneous(2) Targeted(10) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Fasl APN 1 161781838 missense probably damaging 0.99
IGL01510:Fasl APN 1 161781953 missense possibly damaging 0.50
riogrande UTSW 1 161788164 missense probably benign 0.00
ANU22:Fasl UTSW 1 161781838 missense probably damaging 0.99
R0012:Fasl UTSW 1 161788164 missense probably benign
R0454:Fasl UTSW 1 161787954 missense probably benign 0.16
R2167:Fasl UTSW 1 161787138 missense probably benign 0.00
R3794:Fasl UTSW 1 161781737 missense probably benign 0.16
R3911:Fasl UTSW 1 161788191 missense probably benign 0.10
R4082:Fasl UTSW 1 161781851 missense probably damaging 1.00
R4596:Fasl UTSW 1 161788269 missense probably benign 0.31
R4622:Fasl UTSW 1 161787134 missense probably benign 0.00
R6785:Fasl UTSW 1 161781835 missense probably benign 0.10
R6969:Fasl UTSW 1 161781675 missense probably damaging 0.98
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
MMRRC Submission 038208-MU
Last Updated 2016-05-13 3:09 PM by Anne Murray
Record Created 2015-06-30 9:04 PM by Kuan-Wen Wang
Record Posted 2015-08-05
Phenotypic Description

Figure 1. Homozygous riogrande2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The riogrande2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2167, some of which showed exhibited diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent IgG responses to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R2167.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The diminished T-dependent antibody response to rSFV-β-gal was linked by continuous variable mapping to a mutation in Fasl:  an A to C transversion at base pair 161,787,138 (v38) on chromosome 1, or base pair 8,401 in the GenBank genomic region NC_000067.  Linkage was found with a recessive model of inheritance (P = 2.666 x 10-6), wherein 1 variant homozygote departed phenotypically from 4 homozygous reference mice and 9 heterozygous mice (Figure 2).  

 

The mutation corresponds to residue 565 in the mRNA sequence NM_010177 within exon 2 of 4 total exons.

 

550 GAGTTCACCAACCAAAGCCTTAAAGTATCATCT

114 -E--F--T--N--Q--S--L--K--V--S--S-

 

The mutated nucleotide is indicated in red.  The mutation results in a serine (S) to arginine (R) substitution at position 119 (S119R) in the FasL protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.001) (1).

Protein Prediction

Figure 3. Domain structure of FasL. The riogrande2 mutation results in a serine (S) to arginine (R) substitution at position 119 (S119R). The sites of SSPL2a and ADAM10/MMP3/MMP7 cleavage are shown. See the text for more details. Abbreviations: PRD, proline-rich domain; Poly-Pro, polyproline domain; TM, transmembrane domain; SA, self-assembly region; THD, tumor necrosis factor homology domain; ICD, intracellular domain. This image is interactive. Click on the image to view other mutations found in FasL. Click on each mutation for more specific information.

Fasl encodes Fas ligand (FasL; alternatively, CD95L, TNFSF6, or CD178), a type II membrane protein and member of the tumor necrosis factor (TNF; see the record for Dome) family [reviewed in (2;3)]. The 279 amino acid mouse FasL consists of an intracellular domain (ICD; amino acids 1-78), a transmembrane domain (amino acids 79-100), and an extracellular TNF homology domain (THD; amino acids 101-279) that contains the Fas (see the record for cherry) receptor-binding site [Figure 3; (4); reviewed in (2)]. A proline-rich domain (PRD) and polyproline domain within the ICD (amino acids 4-69 and 45-51, respectively) facilitate the binding of Src homology 3 (SH3) or WW domain-containing proteins (e.g., Fyn, Nck, SNX9, SNX18, SNX33, and CD2BP1) to FasL [(5); reviewed in (2;3)].

 

FasL occurs in both a membrane-bound (mFasL) and soluble form (sFasL) as a result of proteolytic processing of FasL. A disintegrin and metallopeptidase domain 10 (ADAM10; for information about ADAM family member, Adam17, please see the record wavedX) cleaves FasL between Lys127 and Gln128. Following cleavage by ADAM10, FasL is further processed by signal peptide peptidase-like 2a (SPPL2a; amino acids 79-80). Metalloproteinase-3 (MMP3) and MMP7 (see the record cartoon for information about MMP family member Mmp14) have also been linked to the cleavage of FasL between Lys127 and Gln128 in some cells (e.g., glandular epithelial cells) (6).

 

The riogrande2 mutation results in a serine to arginine substitution at position 119 (S119R) within the THD domain.

 

Please see the record riogrande for more information about Fasl.

Putative Mechanism

The FasL/Fas receptor system has several functions: (i) acting as a pro-apoptotic factor, (ii) facilitating the removal of target cells by NK and cytotoxic T lymphocytes (CTLs), (iii) maintaining immune-privileged sites, (iv) preventing autoimmunity, (v) regulating resting T cell activation by acting as a non-apoptotic costimulatory ligand/receptor, (vi) acting as a proinflammatory signal, (vii) acting as a proliferative/promigratory signal, and (viii) assisting in tumor cell survival [reviewed in (2;7)]. Loss of Fasl expression results in leukocytosis, splenomegaly, enlarged peripheral lymph nodes, and premature death by 4-5 months (8-10). Mutations in FASL are linked to autoimmune lymphoproliferative syndrome, type IB (ALPS; OMIM: #601859) (11). In ALPS, patients exhibit nonmalignant lymphadenopathy with splenomegaly (12). ALPS is an autosomal dominant disorder of FasL-induced apoptosis, resulting in the accumulation of autoreactive lymphocytes and the production of autoantibodies (13). Patients with ALPS may also exhibit includes Coombs-positive hemolytic anemia, chronic immune thrombocytopenic purpura, and neutropenia (12).

 

In both B and T cell development, apoptosis is essential to maintain immune cell homeostasis. Immature cells that fail to undergo proper V(D)J rearrangement and subsequently fail to express surface antigen receptors (BCR or TCR) undergo apoptosis. Fas/FasL-induced apoptosis is essential for the deletion of autoreactive thymocytes and immature B cells in the bone marrow [(14;15); reviewed in (16)]. Homozygous Fasl ΔIntra mice, a knockin model that expresses a FasL protein that lacks the ICD but expresses a functional, truncated mFasL, exhibited elevated plasma cells and increased generation of germinal center B cells, leading to increased titers of NP-specific IgM antibodies in the serum after immunization with 3-hydroxy 4-nitrophenylacetyl chicken gamma globulin (NP-CGG) (17). T-independent immunization of homozygous Fasl ΔIntra mice with NP-Ficoll resulted in increased plasma cell number as well as NP-specific IgM titers (17). In addition, the Fasl-/- and Fasldel mice exhibited increased IgG and IgM levels compared to wild-type levels (8;10). The riogrande2 mice exhibit reduced T-dependent IgG responses to rSFV, indicating that the activation of B and/or T cells in the riogrande2 mice may be negatively affected by the Fasl mutation.

Primers PCR Primer
riogrande2(F):5'- GTCAAAAGCTCCTCAGGGTTTC -3'
riogrande2(R):5'- CCTCTCTGAGTTGTCAAGGGTG -3'

Sequencing Primer
riogrande2_seq(F):5'- CCTCAGGGTTTCATGCCTAGG -3'
riogrande2_seq(R):5'- CGCTGCTTCATGTTTAGTGATTCAAG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Bruce Beutler
List |< first << previous [record 16 of 17] next >> last >|