Allele | riogrande2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 161,614,707 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ G (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Fasl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | Fas ligand | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Fasl, CD95L, APT1LG1, Tnfsf6, Fas-L, CD178 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 161,608,260-161,616,064 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014] PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_010177, NM_001205243; MGI:99255 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Serine changed to Arginine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000000834] [ENSMUSP00000141422] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P41047 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000000834 Gene: ENSMUSG00000000817 AA Change: S119R
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000141422 Gene: ENSMUSG00000000817
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.0898 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Possibly nonessential (E-score: 0.418) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All mutations/alleles(15) : Chemically induced (ENU)(1) Spontaneous(2) Targeted(10) Transgenic(2) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 038208-MU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:45 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2015-06-30 9:04 PM by Kuan-Wen Wang | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2015-08-05 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The riogrande2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2167, some of which showed exhibited diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The diminished T-dependent antibody response to rSFV-β-gal was linked by continuous variable mapping to a mutation in Fasl: an A to C transversion at base pair 161,787,138 (v38) on chromosome 1, or base pair 8,401 in the GenBank genomic region NC_000067. Linkage was found with a recessive model of inheritance (P = 2.666 x 10-6), wherein 1 variant homozygote departed phenotypically from 4 homozygous reference mice and 9 heterozygous mice (Figure 2). The mutation corresponds to residue 565 in the mRNA sequence NM_010177 within exon 2 of 4 total exons.
The mutated nucleotide is indicated in red. The mutation results in a serine (S) to arginine (R) substitution at position 119 (S119R) in the FasL protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.001) (1). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Fasl encodes Fas ligand (FasL; alternatively, CD95L, TNFSF6, or CD178), a type II membrane protein and member of the tumor necrosis factor (TNF; see the record for Dome) family [reviewed in (2;3)]. The 279 amino acid mouse FasL consists of an intracellular domain (ICD; amino acids 1-78), a transmembrane domain (amino acids 79-100), and an extracellular TNF homology domain (THD; amino acids 101-279) that contains the Fas (see the record for cherry) receptor-binding site [Figure 3; (4); reviewed in (2)]. A proline-rich domain (PRD) and polyproline domain within the ICD (amino acids 4-69 and 45-51, respectively) facilitate the binding of Src homology 3 (SH3) or WW domain-containing proteins (e.g., Fyn, Nck, SNX9, SNX18, SNX33, and CD2BP1) to FasL [(5); reviewed in (2;3)]. FasL occurs in both a membrane-bound (mFasL) and soluble form (sFasL) as a result of proteolytic processing of FasL. A disintegrin and metallopeptidase domain 10 (ADAM10; for information about ADAM family member, Adam17, please see the record wavedX) cleaves FasL between Lys127 and Gln128. Following cleavage by ADAM10, FasL is further processed by signal peptide peptidase-like 2a (SPPL2a; amino acids 79-80). Metalloproteinase-3 (MMP3) and MMP7 (see the record cartoon for information about MMP family member Mmp14) have also been linked to the cleavage of FasL between Lys127 and Gln128 in some cells (e.g., glandular epithelial cells) (6). The riogrande2 mutation results in a serine to arginine substitution at position 119 (S119R) within the THD domain. Please see the record riogrande for more information about Fasl. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The FasL/Fas receptor system has several functions: (i) acting as a pro-apoptotic factor, (ii) facilitating the removal of target cells by NK and cytotoxic T lymphocytes (CTLs), (iii) maintaining immune-privileged sites, (iv) preventing autoimmunity, (v) regulating resting T cell activation by acting as a non-apoptotic costimulatory ligand/receptor, (vi) acting as a proinflammatory signal, (vii) acting as a proliferative/promigratory signal, and (viii) assisting in tumor cell survival [reviewed in (2;7)]. Loss of Fasl expression results in leukocytosis, splenomegaly, enlarged peripheral lymph nodes, and premature death by 4-5 months (8-10). Mutations in FASL are linked to autoimmune lymphoproliferative syndrome, type IB (ALPS; OMIM: #601859) (11). In ALPS, patients exhibit nonmalignant lymphadenopathy with splenomegaly (12). ALPS is an autosomal dominant disorder of FasL-induced apoptosis, resulting in the accumulation of autoreactive lymphocytes and the production of autoantibodies (13). Patients with ALPS may also exhibit includes Coombs-positive hemolytic anemia, chronic immune thrombocytopenic purpura, and neutropenia (12). In both B and T cell development, apoptosis is essential to maintain immune cell homeostasis. Immature cells that fail to undergo proper V(D)J rearrangement and subsequently fail to express surface antigen receptors (BCR or TCR) undergo apoptosis. Fas/FasL-induced apoptosis is essential for the deletion of autoreactive thymocytes and immature B cells in the bone marrow [(14;15); reviewed in (16)]. Homozygous Fasl ΔIntra mice, a knockin model that expresses a FasL protein that lacks the ICD but expresses a functional, truncated mFasL, exhibited elevated plasma cells and increased generation of germinal center B cells, leading to increased titers of NP-specific IgM antibodies in the serum after immunization with 3-hydroxy 4-nitrophenylacetyl chicken gamma globulin (NP-CGG) (17). T-independent immunization of homozygous Fasl ΔIntra mice with NP-Ficoll resulted in increased plasma cell number as well as NP-specific IgM titers (17). In addition, the Fasl-/- and Fasldel mice exhibited increased IgG and IgM levels compared to wild-type levels (8;10). The riogrande2 mice exhibit reduced T-dependent IgG responses to rSFV, indicating that the activation of B and/or T cells in the riogrande2 mice may be negatively affected by the Fasl mutation. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer riogrande2_pcr_F: GTCAAAAGCTCCTCAGGGTTTC riogrande2_pcr_R: CCTCTCTGAGTTGTCAAGGGTG Sequencing Primer riogrande2_seq_F: CCTCAGGGTTTCATGCCTAGG riogrande2_seq_R: CGCTGCTTCATGTTTAGTGATTCAAG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 466 nucleotides is amplified (chromosome 1, - strand): 1 cctctctgag ttgtcaaggg tgtttgatga gcttctcgct gcttcatgtt tagtgattca Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Kuan-Wen Wang, Jin Huk Choi, Bruce Beutler |