Phenotypic Mutation 'Lilliputian'

• Allele: Lilliputian
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 158,544,560 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Pappa2
• Gene Name: pappalysin 2
• Synonym(s): PAPP-A2, placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PLAC3, Pappe
• Chromosomal Location: 158,539,297-158,788,019 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010] ; PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Phenylalanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000124022]
• AlphaFold: E9PZ87
• SMART Domains: Protein: ENSMUSP00000124022; Gene: ENSMUSG00000073530; AA Change: C1756F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Laminin_G_3	271	440	1.2e-25	PFAM
NL	572	614	2.81e-5	SMART
Pfam:Peptidase_M43	669	832	1.5e-12	PFAM
Blast:FN3	844	1103	1e-169	BLAST
low complexity region	1130	1139	N/A	INTRINSIC
low complexity region	1361	1370	N/A	INTRINSIC
CCP	1394	1457	4.97e0	SMART
CCP	1462	1519	4.81e-1	SMART
CCP	1523	1588	2.58e-4	SMART
CCP	1593	1644	1.13e0	SMART
NL	1720	1757	2.66e-6	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000159861)
• Meta Mutation Damage Score: 0.9598
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 6/8
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Sperm, gDNA
• Last Updated: 2019-09-04 9:45 PM by Diantha La Vine
• Record Created: 2015-07-07 9:46 AM
• Record Posted: 2016-06-02
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001085376; MGI:3051647

Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (other)(2) Targeted(4)

Phenotypic Description

Figure 1. Lilliputian mice exhibit reduced body weights compared to wild-type littermates . Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lilliputian phenotype was identified among G3 mice of the pedigree R0418, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R0418. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. The body weight phenotype was linked to mutations in two genes on chromosome 1: Pappa2 and Suco. The mutation in Pappa2 was presumed to be causative because the Lilliputian phenotype mimics that of other Pappa2 mouse models (see MGI). Additionally, the Pappa2 mutation was predicted to be probably damaging (PPN: 1.00), while the Suco mutation was probably benign (PPN: 0.064).

The mutation in Pappa2 is a G to T transversion at base pair 158,716,990 (v38) on chromosome 1, or base pair 263,534 in the GenBank genomic region NC_000067 encoding Pappa2. Linkage was found with an additive model of inheritance (P = 3.674 x 10^-7), wherein eight variant homozygotes and 13 heterozygotes departed phenotypically from seven homozygous reference mice (Figure 2).

The mutation corresponds to residue 5,267 in the mRNA sequence NM_001085376 in exon 21 of 22 total exons. 

5251 TATGACGGGGGAGACTGCTGCTCTTCCACACTC 1751 -Y--D--G--G--D--C--C--S--S--T--L-

The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to phenylalanine (F) substitution at position 1,756 (C1756F) in the PAPP-A2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain figure of PAPP-A2. The Lilliputian mutation results in a cysteine (C) to phenylalanine (F) substitution at position 1,756 (C1756F). Abbreviations: SP, signal peptide; Laminin, laminin G-like domain; LNR, Lin12/Notch repeats; FN3, fibronectin 3-like domain; CCP/SCR, complement control protein/short consensus repeat. This image is interactive. Other mutations found in PAPP-A2 are noted. Click on each mutation for more information.

Pappa2 encodes pregnancy-associated plasma protein A2 (PAPP-A2; alternatively, PAPP-E), a member of the pappalysin subfamily of the metzincin protease family along with PAPP-A and ulilysin. PAPP-A2 shares 62% homology to PAPP-A (1). PAPP-A2 is a 1,789-amino acid protein that has several domains: a signaling peptide (amino acids 1-18), a laminin G-like domain (amino acids 271-440), a peptidase/proteolytic domain (amino acids 669-832), a fibronectin 3-like domain (FN3; amino acids 844-1103), four complement control protein (CCP) domains (alternatively, short consensus repeat (SCR); amino acids 1394-1457, 1462-1519, 1523-1588, and 1593-1644), and two Lin12/Notch repeats (LNRs; amino acids 572-614 and 1720-1757) (Figure 3) (1).

Laminin G-like domains are 180-200 amino acid modules found in extracellular matrix glycoproteins such as laminin, perlecan, and agrin (2). In these ECM proteins, the laminin G-like domains mediate binding to heparin, integrins, and the cell surface receptor α-dystroglycan (α-DG) as well as to sulfated carbohydrates and extracellular ligands (2;3). Association between the laminin G-like domain-containing ECM proteins and heparin or α-DG is essential for basement membrane assembly as well as muscle and nerve cell function. Laminin G-like domains are comprised of a 14-stranded β sandwich with a calcium ion bound to one edge of the sandwich (2).

The PAPP-A2 peptidase domain is common to metallopeptidases belonging to the MEROPS peptidase M43 (cytophagalysin family, clan MA(M)), subfamily M43. The active site in the peptidase domain occurs in a HEXXH motif, which forms part of the metal-binding site (4).

FN3 repeats are found in several types of proteins, including extracellular-matrix molecules, cell-surface receptors, enzymes, and muscle proteins (5). FN3 domains have a conserved beta sandwich fold with one beta sheet containing four strands and the other sheet containing three strands; the fold of the FN3 domain is similar to that of immunoglobulin-like domains. The FN3 domains mediate interactions with other proteins, often through an Arg-Gly-Asp (RGD) sequence found within the FN3 domain.

The CCP domains have a consensus sequence spanning ~60 residues containing four invariant cysteine residues forming two disulfide-bridges (I-III and II-IV), a highly conserved tryptophan, and conserved glycine, proline, and hydrophobic residues (6). The CCP domains mediates recognition processes such as the binding of complement factors to fragments C3b and C4b (6). CCP domains fold into a small and compact hydrophobic core enveloped by six beta-strands and stabilized by two disulfide bridges; the topology of the other strands relative to this central conserved core is variable (7;8).

LNRs are typically found only in Notch receptors. LNRs bind calcium and determine proteolytic specificity. The LNRs are approximately 35-40 amino acids in length. Each LNR contains six cysteine residues engaged in three disulfide bonds and three conserved aspartate and asparagine residues, which are proposed to coordinate the calcium ion (9).

PAPPA2 is proposed to undergo alternative splicing. The alternative transcript encodes a 826-amino acid precursor protein that corresponds to the N-terminus of PAPP-A2 (10). Both variants are co-expressed in the placenta, with low expression in the kidney, fetal brain, and pancreas. The short PAPP-A2 variant is predicted to be secreted extracellularly, while the full-length PAPP-A2 is targeted to the nucleus.

The Lilliputian mutation results in a cysteine (C) to phenylalanine (F) substitution at position 1,756 (C1756F). Amino acid 1,756 is within the second LNR and may result in loss of proteolytic specificity or calcium binding.

Expression/Localization

Pappa2 is highly expressed in the placenta, specifically at the interface of the maternal and fetal layers (11). Highest expression of Pappa2 was in the adult mouse calvaria (i.e., skullcap) and prostate (12). Pappa2 is also expressed in the colon, kidney, lung, brain, ovary, testis, tibia, and spinal cord. Pappa2 was not expressed in the spleen, skeletal muscle, adipose tissue, thymus, uterus, heart, liver, lymph nodes, and skin (12).

PAPP-A2 is upregulated in the placenta during pregnancies complicated by pre-eclampsia (13-16). In addition, PAPP-A2 mRNA and protein expression is increased in second trimester placental samples that have Trisomy 21 compared to age-matched controls (17). PAPP-A2 was also increased in maternal serum from Down syndrome pregnancies compared to diploid pregnancies.

Background

Figure 4. PAPP-A2 functions in the processing of IGFBP5. In IGF-1R-associated signaling, the MAPK and Akt/mTOR pathways are essential for cell proliferation, differentiation, protein synthesis, cell survival, and metabolism. PI3K signals mTORC1 via Akt, which inactivates TSC to prevent inibition of mTORC1. mTORC1 mediates several downstream effects in the cell including suppression of autophagy, activation of transcription leading to mitochondrial metabolism, increased protein synthesis, proliferation, and growth factor production.

Insulin-like growth factors (IGFs) are essential for the regulation of growth and development by influencing the proliferation, differentiation, and apoptosis of osteoblasts (18;19). IGFs bind to two types of receptors, IGF-IR and IGF-IIR, subsequently activating downstream tyrosine kinase pathways. In IGF-I-associated signaling, both the IRS-1/phosphoinositide 3-kinase/serine–threonine kinase pathway and the Ras/mitogen-activated protein kinase/extracellular signal-regulated kinase pathway are activated, which subsequently promote cell proliferation, tissue differentiation, and protection from apoptosis (Figure 4).  

IGF binding proteins (IGFBPs) are carrier proteins that regulate the bioavailability of the IGFs by prolonging their-half-life and circulation turnover. IGF release and IGF-related signaling is mediated by the cleavage of the IGFBPs by proteases. PAPP-A2 is a protease that acts on insulin-like growth factor binding protein 5 (IGFBP5), a factor involved in bone metabolism (18;20) and IGFBP3 (21). IGFBP5 regulates the IGF-I signaling pathways by binding IGF-I. IGFBP5 also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor to enter the cytoplasm and subsequently interact with, and regulate, other proteins. IGFBP3 is a carrier protein for both IGF1 and IGF2 in the circulation. IGFBP3 acts as a growth inhibitor in the extravascular tissue compartment. IGFBP3 can also interact with cell surface proteins, altering cell signaling. IGFBP3 can enter the cell nucleus to subsequently bind to nuclear hormone receptors and other ligands.

PAPP-A2 has roles in human pregnancy (22), reproductive traits in cattle (23), and postnatal growth in mice (12;24). During human pregnancy, circulating IGFBP-5 undergoes PAPP-A2-mediated cleavage resulting in increased IGF bioavailability, which is essential for the development of the fetus (22). In cattle, mutations in Pappa2 result in cattle that have difficulty giving birth, due to changes in the size or shop of the mother’s pelvis (23). Pappa2-deficient (Pappa2^-/-) mice are viable, but smaller than wild-type mice (12). At 3-18 weeks of age, the male Pappa2^-/- mice had approximately 10% lower body weights than that in age-matched wild-type mice (12). Weight reduction was more pronounced in female mice compared to that in age-matched male mice (12). In the female mice, all organs except ovaries were larger than that in wild-type mice. The Pappa2^-/- mice have shorter femur length than that in wild-type mice, but did not exhibit changes in bone mineral density. Pappa2 deletion did not affect placental or embryonic mass at embryonic day 12.5 (25). At birth, the Pappa2^-/- mice exhibited a trend towards lower birth mass (25). At 3, 6, and 10 weeks of age, the Pappa2^-/- mice exhibited reduced body mass and tail lengths compared to wild-type mice (25). The shape of the pelvic girdle significantly differed between that in the Pappa2^-/- and wild-type mice; the Pappa2^-/- mice had a more feminine shape and were disproportionately small (25). Matings between Pappa2^-/- mice exhibited a delay to first litter, increased number of days between litters, and a reduced number of pups per litter compared to matings between wild-type mice (12). Although Pappa2 deletion resulted in diminished levels of circulating IGF-I, IGFBP-3, and IGFBP-5, there were no glucose metabolism phenotypes observed (26). In addition, loss of Pappa2 expression did not result in weight gain or adiposity after a high-fat diet (26). Loss of Pappa2 expression in mouse did not affect female fertility, but had subtle effects on male fertility (27). Conditional deletion of Pappa2 in osteoclasts resulted in reduced body mass, tail length, and linear bone dimensions compared to that in wild-type mice (28). Taken together, this indicates that PAPP-A2 expression both in the bone and by other cell types is essential for postnatal growth.

Putative Mechanism

Mutations in Pappa2 are known to cause reduced postnatal growth in mice (12;24;25;28). The phenotype of the Lilliputian mice indicates that PAPP-A2 exhibits loss of function, subsequent leading to inhibited actions of IGFBP5 and IGFBP3.

Primers

PCR Primer
Lilliputian_pcr_F: CTCCCAATGACTTCAGATTCTCCAGTG
Lilliputian_pcr_R: TGGACTCAAAGGTTTCTTTCCTAAGGC

Sequencing Primer
Lilliputian_seq_F: GACTTCAGATTCTCCAGTGTTAATCC
Lilliputian_seq_R: GGTGCTCATTCACAATCTCTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 429 nucleotides is amplified (chromosome 1, - strand):

1   tggactcaaa ggtttctttc ctaaggcttt tcaatgtttt gagaatgtag tttgcctttt
61  gggtgctcat tcacaatctc ttgagtattt ggtttatttg gttggagtca gaggtgattt
121 tgggaagtgg gaagggggca agttccacag gacactgact ttgtctcttt acagcctttc
181 caagcagatg gttggtgtga cactattaat aaccgggcct actgcaacta tgacggggga
241 gactgctgct cttccacact ctcttccaag aaggtaagtg gagtaacagg gatgggtgga
301 gaggccaagg ctctggaacc agtggggctt ttgctagctc tccttcacag tgcatcataa
361 ctggctcttg cccagtcatt aagagggaaa tacaaggatt aacactggag aatctgaagt
421 cattgggag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Farr, M., Strube, J., Geppert, H. G., Kocourek, A., Mahne, M., and Tschesche, H. (2000) Pregnancy-Associated Plasma Protein-E (PAPP-E). Biochim Biophys Acta. 1493, 356-362.

  2. Hohenester, E., Tisi, D., Talts, J. F., and Timpl, R. (1999) The Crystal Structure of a Laminin G-Like Module Reveals the Molecular Basis of Alpha-Dystroglycan Binding to Laminins, Perlecan, and Agrin. Mol Cell. 4, 783-792.

  3. Timpl, R., Tisi, D., Talts, J. F., Andac, Z., Sasaki, T., and Hohenester, E. (2000) Structure and Function of Laminin LG Modules. Matrix Biol. 19, 309-317.

  4. Rawlings, N. D., and Barrett, A. J. (1995) Evolutionary Families of Metallopeptidases. Methods Enzymol. 248, 183-228.

  5. Bork, P., and Doolittle, R. F. (1992) Proposed Acquisition of an Animal Protein Domain by Bacteria. Proc Natl Acad Sci U S A. 89, 8990-8994.

  6. Reid, K. B., and Day, A. J. (1989) Structure-Function Relationships of the Complement Components. Immunol Today. 10, 177-180.

  7. Norman, D. G., Barlow, P. N., Baron, M., Day, A. J., Sim, R. B., and Campbell, I. D. (1991) Three-Dimensional Structure of a Complement Control Protein Module in Solution. J Mol Biol. 219, 717-725.

  8. Gaboriaud, C., Rossi, V., Bally, I., Arlaud, G. J., and Fontecilla-Camps, J. C. (2000) Crystal Structure of the Catalytic Domain of Human Complement c1s: A Serine Protease with a Handle. EMBO J. 19, 1755-1765.

  9. Aster, J. C., Simms, W. B., Zavala-Ruiz, Z., Patriub, V., North, C. L., and Blacklow, S. C. (1999) The Folding and Structural Integrity of the First LIN-12 Module of Human Notch1 are Calcium-Dependent. Biochemistry. 38, 4736-4742.

  10. Page, N. M., Butlin, D. J., Lomthaisong, K., and Lowry, P. J. (2001) The Characterization of Pregnancy Associated Plasma Protein-E and the Identification of an Alternative Splice Variant. Placenta. 22, 681-687.

  11. Wang, J., Qiu, Q., Haider, M., Bell, M., Gruslin, A., and Christians, J. K. (2009) Expression of Pregnancy-Associated Plasma Protein A2 during Pregnancy in Human and Mouse. J Endocrinol. 202, 337-345.

  12. Conover, C. A., Boldt, H. B., Bale, L. K., Clifton, K. B., Grell, J. A., Mader, J. R., Mason, E. J., and Powell, D. R. (2011) Pregnancy-Associated Plasma Protein-A2 (PAPP-A2): Tissue Expression and Biological Consequences of Gene Knockout in Mice. Endocrinology. 152, 2837-2844.

  13. Wagner, P. K., and Christians, J. K. (2010) Altered Placental Expression of PAPPA2 does Not Affect Birth Weight in Mice. Reprod Biol Endocrinol. 8, 90-7827-8-90.

  14. Macintire, K., Tuohey, L., Ye, L., Palmer, K., Gantier, M., Tong, S., and Kaitu'u-Lino, T. J. (2014) PAPPA2 is Increased in Severe Early Onset Pre-Eclampsia and Upregulated with Hypoxia. Reprod Fertil Dev. 26, 351-357.

  15. Nishizawa, H., Pryor-Koishi, K., Suzuki, M., Kato, T., Kogo, H., Sekiya, T., Kurahashi, H., and Udagawa, Y. (2008) Increased Levels of Pregnancy-Associated Plasma Protein-A2 in the Serum of Pre-Eclamptic Patients. Mol Hum Reprod. 14, 595-602.

  16. Winn, V. D., Gormley, M., Paquet, A. C., Kjaer-Sorensen, K., Kramer, A., Rumer, K. K., Haimov-Kochman, R., Yeh, R. F., Overgaard, M. T., Varki, A., Oxvig, C., and Fisher, S. J. (2009) Severe Preeclampsia-Related Changes in Gene Expression at the Maternal-Fetal Interface Include Sialic Acid-Binding Immunoglobulin-Like Lectin-6 and Pappalysin-2. Endocrinology. 150, 452-462.

  17. Munnangi, S., Gross, S. J., Madankumar, R., Salcedo, G., and Reznik, S. E. (2014) Pregnancy Associated Plasma Protein-A2: A Novel Biomarker for Down Syndrome. Placenta. 35, 900-906.

  18. Govoni, K. E., Baylink, D. J., and Mohan, S. (2005) The Multi-Functional Role of Insulin-Like Growth Factor Binding Proteins in Bone. Pediatr Nephrol. 20, 261-268.

  19. Mohan, S., Richman, C., Guo, R., Amaar, Y., Donahue, L. R., Wergedal, J., and Baylink, D. J. (2003) Insulin-Like Growth Factor Regulates Peak Bone Mineral Density in Mice by both Growth Hormone-Dependent and -Independent Mechanisms. Endocrinology. 144, 929-936.

  20. Conover, C. A. (2008) Insulin-Like Growth Factor-Binding Proteins and Bone Metabolism. Am J Physiol Endocrinol Metab. 294, E10-4.

  21. Overgaard, M. T., Boldt, H. B., Laursen, L. S., Sottrup-Jensen, L., Conover, C. A., and Oxvig, C. (2001) Pregnancy-Associated Plasma Protein-A2 (PAPP-A2), a Novel Insulin-Like Growth Factor-Binding Protein-5 Proteinase. J Biol Chem. 276, 21849-21853.

  22. Yan, X., Baxter, R. C., and Firth, S. M. (2010) Involvement of Pregnancy-Associated Plasma Protein-A2 in Insulin-Like Growth Factor (IGF) Binding Protein-5 Proteolysis during Pregnancy: A Potential Mechanism for Increasing IGF Bioavailability. J Clin Endocrinol Metab. 95, 1412-1420.

  23. Wickramasinghe, S., Rincon, G., and Medrano, J. F. (2011) Variants in the Pregnancy-Associated Plasma Protein-A2 Gene on Bos Taurus Autosome 16 are Associated with Daughter Calving Ease and Productive Life in Holstein Cattle. J Dairy Sci. 94, 1552-1558.

  24. Christians, J. K., Hoeflich, A., and Keightley, P. D. (2006) PAPPA2, an Enzyme that Cleaves an Insulin-Like Growth-Factor-Binding Protein, is a Candidate Gene for a Quantitative Trait Locus Affecting Body Size in Mice. Genetics. 173, 1547-1553.

  25. Christians, J. K., de Zwaan, D. R., and Fung, S. H. (2013) Pregnancy Associated Plasma Protein A2 (PAPP-A2) Affects Bone Size and Shape and Contributes to Natural Variation in Postnatal Growth in Mice. PLoS One. 8, e56260.

  26. Christians, J. K., Bath, A. K., and Amiri, N. (2015) Pappa2 Deletion Alters IGFBPs but has Little Effect on Glucose Disposal Or Adiposity. Growth Horm IGF Res. 25, 232-239.

  27. Christians, J. K., King, A. Y., Rogowska, M. D., and Hessels, S. M. (2015) Pappa2 Deletion in Mice Affects Male but Not Female Fertility. Reprod Biol Endocrinol. 13, 109-015-0108-y.

  28. Amiri, N., and Christians, J. K. (2015) PAPP-A2 Expression by Osteoblasts is Required for Normal Postnatal Growth in Mice. Growth Horm IGF Res. 25, 274-280.