Phenotypic Mutation 'Lilliputian' (pdf version)
List |< first << previous [record 20 of 30] next >> last >|
AlleleLilliputian
Mutation Type missense
Chromosome1
Coordinate158,716,990 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Pappa2
Gene Name pappalysin 2
Synonym(s) pregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Chromosomal Location 158,711,727-158,980,490 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001085376; MGI:3051647

Mapped Yes 
Amino Acid Change Cysteine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000124022]
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: C1756F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000159861)
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 23457539
Body Weight (Male) - decreased 23457539
growth/size
Penetrance 6/8 
Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (other)(2) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
gulliver UTSW 1 158857136 missense
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
Repository
Last Updated 2019-01-15 5:16 PM by Diantha La Vine
Record Created 2015-07-07 9:46 AM
Record Posted 2016-06-02
Phenotypic Description

Figure 1. Lilliputian mice exhibit reduced body weights compared to wild-type littermates. Scaled body weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lilliputian phenotype was identified among G3 mice of the pedigree R0418, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R0418. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. The body weight phenotype was linked to mutations in two genes on chromosome 1: Pappa2 and Suco. The mutation in Pappa2 was presumed to be causative because the Lilliputian phenotype mimics that of other Pappa2 mouse models (see MGI). Additionally, the Pappa2 mutation was predicted to be probably damaging (PPN: 1.00), while the Suco mutation was probably benign (PPN: 0.064).

 

The mutation in Pappa2 is a G to T transversion at base pair 158,716,990 (v38) on chromosome 1, or base pair 263,534 in the GenBank genomic region NC_000067 encoding Pappa2. Linkage was found with an additive model of inheritance (P = 3.674 x 10-7), wherein eight variant homozygotes and 13 heterozygotes departed phenotypically from seven homozygous reference mice (Figure 2).

 

The mutation corresponds to residue 5,267 in the mRNA sequence NM_001085376 in exon 21 of 22 total exons. 

 

5251 TATGACGGGGGAGACTGCTGCTCTTCCACACTC

1751 -Y--D--G--G--D--C--C--S--S--T--L-

 

The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to phenylalanine (F) substitution at position 1,756 (C1756F) in the PAPP-A2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain figure of PAPP-A2. The Lilliputian mutation results in a cysteine (C) to phenylalanine (F) substitution at position 1,756 (C1756F). Abbreviations: SP, signal peptide; Laminin, laminin G-like domain; LNR, Lin12/Notch repeats; FN3, fibronectin 3-like domain; CCP/SCR, complement control protein/short consensus repeat. This image is interactive. Other mutations found in PAPP-A2 are noted. Click on each mutation for more information.

Pappa2 encodes pregnancy-associated plasma protein A2 (PAPP-A2; alternatively, PAPP-E), a member of the pappalysin subfamily of the metzincin protease family along with PAPP-A and ulilysin. PAPP-A2 shares 62% homology to PAPP-A (1). PAPP-A2 is a 1,789-amino acid protein that has several domains: a signaling peptide (amino acids 1-18), a laminin G-like domain (amino acids 271-440), a peptidase/proteolytic domain (amino acids 669-832), a fibronectin 3-like domain (FN3; amino acids 844-1103), four complement control protein (CCP) domains (alternatively, short consensus repeat (SCR); amino acids 1394-1457, 1462-1519, 1523-1588, and 1593-1644), and two Lin12/Notch repeats (LNRs; amino acids 572-614 and 1720-1757) (Figure 3) (1).

 

Laminin G-like domains are 180-200 amino acid modules found in extracellular matrix glycoproteins such as laminin, perlecan, and agrin (2). In these ECM proteins, the laminin G-like domains mediate binding to heparin, integrins, and the cell surface receptor α-dystroglycan (α-DG) as well as to sulfated carbohydrates and extracellular ligands (2;3). Association between the laminin G-like domain-containing ECM proteins and heparin or α-DG is essential for basement membrane assembly as well as muscle and nerve cell function. Laminin G-like domains are comprised of a 14-stranded β sandwich with a calcium ion bound to one edge of the sandwich (2).

 

The PAPP-A2 peptidase domain is common to metallopeptidases belonging to the MEROPS peptidase M43 (cytophagalysin family, clan MA(M)), subfamily M43. The active site in the peptidase domain occurs in a HEXXH motif, which forms part of the metal-binding site (4).

 

FN3 repeats are found in several types of proteins, including extracellular-matrix molecules, cell-surface receptors, enzymes, and muscle proteins (5). FN3 domains have a conserved beta sandwich fold with one beta sheet containing four strands and the other sheet containing three strands; the fold of the FN3 domain is similar to that of immunoglobulin-like domains. The FN3 domains mediate interactions with other proteins, often through an Arg-Gly-Asp (RGD) sequence found within the FN3 domain.

 

The CCP domains have a consensus sequence spanning ~60 residues containing four invariant cysteine residues forming two disulfide-bridges (I-III and II-IV), a highly conserved tryptophan, and conserved glycine, proline, and hydrophobic residues (6). The CCP domains mediates recognition processes such as the binding of complement factors to fragments C3b and C4b (6). CCP domains fold into a small and compact hydrophobic core enveloped by six beta-strands and stabilized by two disulfide bridges; the topology of the other strands relative to this central conserved core is variable (7;8).

 

LNRs are typically found only in Notch receptors. LNRs bind calcium and determine proteolytic specificity. The LNRs are approximately 35-40 amino acids in length. Each LNR contains six cysteine residues engaged in three disulfide bonds and three conserved aspartate and asparagine residues, which are proposed to coordinate the calcium ion (9).

 

PAPPA2 is proposed to undergo alternative splicing. The alternative transcript encodes a 826-amino acid precursor protein that corresponds to the N-terminus of PAPP-A2 (10). Both variants are co-expressed in the placenta, with low expression in the kidney, fetal brain, and pancreas. The short PAPP-A2 variant is predicted to be secreted extracellularly, while the full-length PAPP-A2 is targeted to the nucleus.

 

The Lilliputian mutation results in a cysteine (C) to phenylalanine (F) substitution at position 1,756 (C1756F). Amino acid 1,756 is within the second LNR and may result in loss of proteolytic specificity or calcium binding.

Expression/Localization

Pappa2 is highly expressed in the placenta, specifically at the interface of the maternal and fetal layers (11). Highest expression of Pappa2 was in the adult mouse calvaria (i.e., skullcap) and prostate (12). Pappa2 is also expressed in the colon, kidney, lung, brain, ovary, testis, tibia, and spinal cord. Pappa2 was not expressed in the spleen, skeletal muscle, adipose tissue, thymus, uterus, heart, liver, lymph nodes, and skin (12).

 

PAPP-A2 is upregulated in the placenta during pregnancies complicated by pre-eclampsia (13-16). In addition, PAPP-A2 mRNA and protein expression is increased in second trimester placental samples that have Trisomy 21 compared to age-matched controls (17). PAPP-A2 was also increased in maternal serum from Down syndrome pregnancies compared to diploid pregnancies.

Background
Figure 4. PAPP-A2 functions in the processing of IGFBP5. In IGF-1R-associated signaling, the MAPK and Akt/mTOR pathways are essential for cell proliferation, differentiation, protein synthesis, cell survival, and metabolism. PI3K signals mTORC1 via Akt, which inactivates TSC to prevent inibition of mTORC1. mTORC1 mediates several downstream effects in the cell including suppression of autophagy, activation of transcription leading to mitochondrial metabolism, increased protein synthesis, proliferation, and growth factor production.

Insulin-like growth factors (IGFs) are essential for the regulation of growth and development by influencing the proliferation, differentiation, and apoptosis of osteoblasts (18;19). IGFs bind to two types of receptors, IGF-IR and IGF-IIR, subsequently activating downstream tyrosine kinase pathways. In IGF-I-associated signaling, both the IRS-1/phosphoinositide 3-kinase/serine–threonine kinase pathway and the Ras/mitogen-activated protein kinase/extracellular signal-regulated kinase pathway are activated, which subsequently promote cell proliferation, tissue differentiation, and protection from apoptosis (Figure 4).  

 

IGF binding proteins (IGFBPs) are carrier proteins that regulate the bioavailability of the IGFs by prolonging their-half-life and circulation turnover. IGF release and IGF-related signaling is mediated by the cleavage of the IGFBPs by proteases. PAPP-A2 is a protease that acts on insulin-like growth factor binding protein 5 (IGFBP5), a factor involved in bone metabolism (18;20) and IGFBP3 (21). IGFBP5 regulates the IGF-I signaling pathways by binding IGF-I. IGFBP5 also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor to enter the cytoplasm and subsequently interact with, and regulate, other proteins. IGFBP3 is a carrier protein for both IGF1 and IGF2 in the circulation. IGFBP3 acts as a growth inhibitor in the extravascular tissue compartment. IGFBP3 can also interact with cell surface proteins, altering cell signaling. IGFBP3 can enter the cell nucleus to subsequently bind to nuclear hormone receptors and other ligands.

 

PAPP-A2 has roles in human pregnancy (22), reproductive traits in cattle (23), and postnatal growth in mice (12;24). During human pregnancy, circulating IGFBP-5 undergoes PAPP-A2-mediated cleavage resulting in increased IGF bioavailability, which is essential for the development of the fetus (22). In cattle, mutations in Pappa2 result in cattle that have difficulty giving birth, due to changes in the size or shop of the mother’s pelvis (23). Pappa2-deficient (Pappa2-/-) mice are viable, but smaller than wild-type mice (12). At 3-18 weeks of age, the male Pappa2-/- mice had approximately 10% lower body weights than that in age-matched wild-type mice (12). Weight reduction was more pronounced in female mice compared to that in age-matched male mice (12). In the female mice, all organs except ovaries were larger than that in wild-type mice. The Pappa2-/- mice have shorter femur length than that in wild-type mice, but did not exhibit changes in bone mineral density. Pappa2 deletion did not affect placental or embryonic mass at embryonic day 12.5 (25). At birth, the Pappa2-/- mice exhibited a trend towards lower birth mass (25). At 3, 6, and 10 weeks of age, the Pappa2-/- mice exhibited reduced body mass and tail lengths compared to wild-type mice (25). The shape of the pelvic girdle significantly differed between that in the Pappa2-/- and wild-type mice; the Pappa2-/- mice had a more feminine shape and were disproportionately small (25). Matings between Pappa2-/- mice exhibited a delay to first litter, increased number of days between litters, and a reduced number of pups per litter compared to matings between wild-type mice (12). Although Pappa2 deletion resulted in diminished levels of circulating IGF-I, IGFBP-3, and IGFBP-5, there were no glucose metabolism phenotypes observed (26). In addition, loss of Pappa2 expression did not result in weight gain or adiposity after a high-fat diet (26). Loss of Pappa2 expression in mouse did not affect female fertility, but had subtle effects on male fertility (27). Conditional deletion of Pappa2 in osteoclasts resulted in reduced body mass, tail length, and linear bone dimensions compared to that in wild-type mice (28). Taken together, this indicates that PAPP-A2 expression both in the bone and by other cell types is essential for postnatal growth.

Putative Mechanism

Mutations in Pappa2 are known to cause reduced postnatal growth in mice (12;24;25;28). The phenotype of the Lilliputian mice indicates that PAPP-A2 exhibits loss of function, subsequent leading to inhibited actions of IGFBP5 and IGFBP3.

Primers PCR Primer
Lilliputian(F):5'- CTCCCAATGACTTCAGATTCTCCAGTG -3'
Lilliputian(R):5'- TGGACTCAAAGGTTTCTTTCCTAAGGC -3'

Sequencing Primer
Lilliputian_seq(F):5'- GACTTCAGATTCTCCAGTGTTAATCC -3'
Lilliputian_seq(R):5'- GGTGCTCATTCACAATCTCTTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle and Bruce Beutler
List |< first << previous [record 20 of 30] next >> last >|