Phenotypic Mutation 'gimpy'

• Allele: gimpy
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 91,342,866 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Wnt7a
• Gene Name: wingless-type MMTV integration site family, member 7A
• Synonym(s): tw, Wnt-7a
• Chromosomal Location: 91,340,963-91,388,335 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is involved in the development of the anterior-posterior axis in the female reproductive tract, and also plays a critical role in uterine smooth muscle pattering and maintenance of adult uterine function. Mutations in this gene are associated with Fuhrmann and Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndromes. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutants have skeletal abnormalities including absence of digits, especially of the forelimb, and sometimes absence of the ulna. Occasionally, there is an extra set of ribs. Both sexes are sterile due to abnormalities of the Mullerian duct. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P24383
• SMART Domains: Protein: ENSMUSP00000032180; Gene: ENSMUSG00000030093; AA Change: C339S

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
WNT1	40	349	1.57e-213	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000032180)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly essential (E-score: 0.689)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos
• MMRRC Submission: 030382-UCD
• Last Updated: 2017-09-15 1:28 PM by Anne Murray
• Record Created: unknown
• Record Posted: 2007-08-14
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Karine Crozat, Bruce Beutler

Accession Number

NCBI RefSeq: NM_009527; MGI: 98961

Alleles Listed at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(2) Spontaneous(2) Chemically induced(1)

Phenotypic Description

The gimpy phenotype was identified as a limb/digit malformation defect on the domino background. gimpy mice display malformed and/or extra digits, and occasionally malformed limbs.  These phenotypes segregated in Mendelian ratios separately from the domino phenotype. gimpy mice are sterile, but otherwise healthy.

Nature of Mutation

The gimpy mutation corresponds to a T to A transversion at position 1275 of the Wnt7a transcript on Chromosome 6, in exon 4 of 4 total exons.

1260 GTCAAGTGTAACACGTGCAGCGAGCGCACGGAG

334  -V--K--C--N--T--C--S--E--R--T--E-

 

The mutated nucleotide is indicated in red lettering, and causes a cysteine to serine substitution of amino acid 339 in the Wnt7a protein.

Protein Prediction

The Wnt7a gene encodes a 349-amino acid secreted protein growth factor of the Wnt family, whose members are defined by sequence rather than by functional properties (1;2).  All Wnts contain an N-terminal signal sequence, and 23 or 24 cysteine residues distributed in a highly conserved manner across the length of the protein.  Little is known about the structure of Wnts, as they have been notoriously difficult to solubilize due to their recently discovered palmitoylation on a conserved cysteine residue (3).  This palmitoylation renders Wnt3 hydrophobic, and is essential for Wnt3 signaling ability.  It has been speculated that palmitoylation helps target Wnts to the plasma membrane. Wnt proteins are glycosylated, although this modification does not appear essential for Wnt1 function (4).

 

The gimpy mutation results in a cysteine to serine change at position 339 of Wnt7a, in the 23^rd of the 24 conserved cysteines.  The cysteines have been hypothesized to participate in intramolecular disulfide bonds (2).  Thus, the gimpy mutation may disrupt proper folding of Wnt7a. How Wnt7a expression is affected by the gimpy mutation is unknown.

 

Expression/Localization

Wnts are expressed throughout embryonic development and in the adult, and several share similar temporal patterns of expression in mice (5).  Wnt7a is expressed in the distal dorsal ectoderm and reproductive tract during embryogenesis (6;7), and in the lung and brain in adult mice (5).  Brain expression is predominantly in the cerebellum (8) and olfactory bulb (GNF SymAtlas).

 

Wnts are secreted proteins: they have an amino-terminal signal sequence, are present in the secretory pathway and act non-cell autonomously (2).  Active Wnts can be harvested from the medium of cultured cells (9;10).  At the same time, they can be detected bound to the cell surface in close association with glycosaminoglycans (11;12).  Studies of Drosophila Wingless (Wg, the prototypical Wnt), suggest that Wnts are endocytosed preferentially in cells anterior versus posterior to the Wg source (13), setting up a morphogenetic gradient that regulates epidermal patterning in the fly embryo (14).

Background

Wnts, found in invertebrates and vertebrates, regulate cell fate, proliferation, migration, polarity and death during embryonic development, and contribute to homeostasis and some cancers in adulthood.  There are 19 WNT genes in humans and at least 18 Wnt genes in mice (2).  Wnts have a well-studied role in vertebrate limb development, which proceeds through the stages of limb bud initiation, early limb patterning, and late limb morphogenesis (15;16).  After limb bud formation, patterning depends on signals from the apical ectoderm ridge (AER), the zone of polarizing activity (ZPA), and the non-AER ectoderm.  These signaling centers specify the proximal-distal, anterior-posterior and dorsal-ventral axes, respectively, and mediate their signaling in part through Wnt proteins (15).

 

Studies of Wnt7a mutant mice demonstrate that Wnt7a signaling regulates dorsal-ventral and anterior-posterior limb pattern formation.  Wnt7a is expressed in the dorsal ectoderm (7), and mice lacking Wnt7a activity show dorsal-to-ventral cell fate transformations in the limb mesoderm, indicating that Wnt7a provides a dorsalizing signal (17).  In particular, dermal thickenings representing footpads are found on the dorsal surface of Wnt7a-deficient limbs, and these thickenings also lose hair and acquire striations (17).  Ventral tendons are duplicated dorsally in Wnt7a mutants, preventing flexion of the digits (17).  Anterior-posterior patterning is affected in Wnt7a mutants, as demonstrated by a specific loss of posterior skeletal elements such as digit five and the ulna (17).  Interestingly, these patterning defects appear to be restricted to the distal portion of the limb, suggesting that Wnt7a-indpendent mechanisms control more proximal dorsal-ventral specification.

 

In addition to having defective limb development, Wnt7a mutants are sterile due to abnormal oviduct and uterus development in females, and a failure of Müllerian ducts to regress in males (6).  Postnatal uterine patterning of the female Wnt7a-deficient reproductive tract is abnormal, concomitant with loss of hoxa-10 and hoxa-11 expression (18).  Wnt7a mutants display defects in cerebellar development (8).   Cerebellar granule cells secrete Wnt7a and mossy fibers exhibit a delay in synapse formation on granule cells in Wnt7a-deficient mice, suggesting that Wnt7a promotes synaptogenesis (8).

 

Figure 4. Wnt Signaling Pathways. Wnt glycoproteins are palmitolated by porcupine family proteins (Porcn) and secreted into the extracellular matrix with the assistance of the retromer complex. In the extracelluar matrix, heparan sulfate proteoglycans bind to Wnt proteins, stabilizing them for binding to the seven transmembrane Frizzled receptor and coreceptor LRP5 or LRP6. Several Wnt inhibitors, including Dickkopf (Dkk), Wnt-inhibitor protein (WIF), soluble Frizzled-related proteins (SFRP), Cerberus, Frzb, and Wise, bind Wnts or their receptors directly and prevent Wnt from interacting with LRP5/6 and Frizzled. Canonical Wnt/β-catenin pathway: In the absence of Wnt, β-catenin is constantly degraded. β-catenin is phosphorylated by glycogen synthase kinase 3 (GSK3) and casein kinase 1α (CK1α) in a destruction complex that also contains adenomatous polyposis coli (APC) and Axin. Phosphorylation allows association with β-TrCP, an E3 ubiquitin ligase subunit that targets β-catenin for proteasome-mediated degradation. Thus, β-catenin cannot travel to the nucleus and Wnt target genes are repressed by lymphoid enhancer-binding factor 1/T cell-specific transcription factor (LEF/TCF) proteins. Wnt binding to Frizzled and LRP5/6 results in recruitment of Dishevelled (Dsh) and Axin, and LRP5/6 phosphorylation by GSK3 and CK1γ. Dsh is also phosphorylated by casein kinase 1/2 (CK1/2), metastasis associated kinase (MAK), protein kinase C (PKC), and Par1. These events disrupt the β-catenin destruction complex, thereby permitting the stabilization of β-catenin, which accumulates in the cell and translocates into the nucleus where it associates with and coactivates LEF/TCF to stimulate target gene expression. The two non-canonical Wnt signaling pathways control cell polarization and migration and do not require LRP5/6 nor act through β-catenin. In the Planar Cell Polarity Pathway, Wnt-activated signals arising from Frizzled recruit Dsh to the cell membrane. Dsh activates cytoskeletal regulatory pathways, either directly (for Rac) or through Dishevelled associated activator of morphogenesis 1 (Daam1) (for Rho and profilin). In addition to cytoskeletal regulation, Rac also controls transcription through activation of JNK. In the Wnt/Ca²⁺ Pathway, binding of Wnt to Frizzled recruits G-proteins that activate Dsh. Several molecules subsequently control Ca²⁺ release from the endoplasmic reticulum, including Protein Kinase G (PKG) that inhibits Ca²⁺ release, and phospholipase C (PLC) that stimulates Ca²⁺ release through the generation of IP₃. Diacylglycerol (DAG), also generated by PLC, together with Ca²⁺, activates protein kinase C (PKC), leading to control of tissue separation through Cdc42. Ventral fate is regulated by the Wnt/Ca²⁺ pathway through the action of calcineurin and nuclear factor of activated T cells (NFAT). The Wnt/Ca²⁺ pathway also inhibits the canonical Wnt pathway through calcium/calmodulin-dependent protein kinase II (CamKII), TAK1, and NEMO. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The best studied Wnt signaling pathway is the canonical Wnt/β-catenin pathway, which signals through stabilization of β-catenin to regulate transcription factors controlling gene expression (Figure 1) [reviewed in (1;2)].  The data support a role for the Wnt/β-catenin pathway in cell fate determination during development.  This signaling cascade is initiated by binding of Wnt proteins to receptors of the Frizzled (Fzd) and LDL-receptor-related (LRP) protein families (for a mutation in Lrp5, please see r18), and may be modulated by cell surface proteoglycans that are hypothesized to cluster Wnts for presentation to receptors.  Wnt signals are also modulated by secreted proteins that bind Wnts directly and prevent their binding to Fzd receptors.  These include the Frizzled-related protein (FRP or FrzB), Wnt-inhibitory factor-1 (WIF-1), Cerberus-1 (Cer1), and Dickkopf (Dkk).  Cytoplasmic β-catenin levels are normally kept low by continuous proteasome-mediated degradation, which is controlled by a multi-protein complex including glycogen synthase kinase-3β (GSK3), Adenomatous Polyposis Coli (APC) and Axin.  APC facilitates phosphorylation of β-catenin by GSK3, which allows binding of an E3 ubiquitin ligase complex member and ubiquitination.  When Wnt binds to Fzd or LRP, the scaffolding protein Dishevelled (Dsh) disrupts the GSK3/APC/Axin complex and prevents phosphorylation and ubiquitination of β-catenin, leading to stabilization of β-catenin in the cytoplasm and nucleus.  Nuclear β-catenin interacts with transcription factors such as lymphoid enhancer-binding factor 1/T cell-specific transcription factor (LEF/TCF) to control target gene expression.

 

At least two non-canonical Wnt signaling pathways exist, which function independently of β-catenin (Figure 1) [reviewed in (2)].  Activation of the “Wnt/Ca²⁺” pathway results in increased intracellular Ca²⁺ and stimulation of PKC and a heterotrimeric G protein.  The biological function of this pathway is unknown.   The “Wnt/polarity” pathway controls the polarity of cells through regulating cytoskeletal organization.  The intracellular signaling members of this pathway are under investigation in Drosophila, and so far include DFzd1 (Drosophila Fzd), Dsh, DrhoA, Drok (rho-associated kinase), Jun N-terminal kinase (JNK), myosin II, and myosin VIIA.  Polarized cell movements during gastrulation and neurulation are thought to require the Wnt/polarity pathway.

 

Humans with Fuhrmann syndrome (OMIM #228930) have limb malformations characterized by limb aplasia/hypoplasia and joint dysplasia.  The Al-Awadi/Raas-Rothschild /Schinzel phocomelia syndrome (OMIM #276820) results in more severe limb truncation phenotypes.  Homozygous mutations in WNT7A were found in patients with these syndromes, with loss-of-function mutations causing Fuhrmann syndrome and null mutations causing Al-Awadi/Raas-Rothschild /Schinzel phocomelia syndrome (19).

Putative Mechanism

How Wnt7a regulates dorsal-ventral limb patterning involves at least two other transcription factors, the homeobox-containing Engrailed (En)-1, and the LIM-homeodomain transcription factor Lmx1b. En-1 represses Wnt7a transcription in the ventral ectoderm, thus explaining dorsal ectoderm-specific Wnt7a expression (20).  Wnt7a induces Lmx1b expression in the dorsal mesenchyme to specify dorsal mesodermal cell fate (21).  However, factors other than Wnt7a regulate Lmx1b, as Lmx1b mutants display ventralization of features extending along the entire anterior-posterior axis, and to a more proximal level than observed in Wnt7a mutants (22).

 

It remains unclear whether Wnt7a signals through a canonical or non-canonical Wnt signaling pathway to regulate limb patterning. Wnt7a present in the dorsal ectoderm signals to the underlying mesoderm to maintain dorsal cell fate. Loss of β-catenin in the limb results in dorsal and not ventral transformation, suggesting that Wnt7a may not utilize the canonical Wnt/β-catenin pathway (23).  However, genetic interactions exist between Wnt7a and Lrp6, a canonical Wnt receptor (24), and Wnt7a mutant limb patterning phenotypes are alleviated by reducing Dkk expression in mice (25).  These findings suggest instead that Wnt7a signals through the canonical Wnt/β-catenin pathway.

Primers

Primers cannot be located by automatic search.

Genotyping

Gimpy genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. This protocol has not been tested.

 

Primers for PCR amplification

Gimpy(F): 5’- TCTGAAGATCAAGAAGCCCCTGTCC -3’

Gimpy(R): 5’- GCCGTAGAAAACTTTGTTCCAGCCC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Gimpy_seq(F): 5’- TCGAGAAGTCACCCAATTACTGTG -3’

Gimpy_seq(R): 5’- TCTGAGAGATGCTTCCCACG -3’

 

The following sequence of 557 nucleotides (from Genbank genomic region NC_000072 for linear DNA sequence of Wnt7a) is amplified:

 

45224                                                tctgaag atcaagaagc
45241 ccctgtccta ccgcaagccc atggacactg acctggtgta tatcgagaag tcacccaatt
45301 actgtgaaga ggacccagtg acaggcagcg tgggtaccca gggccgagcc tgcaataaga
45361 cagcccctca ggccagtggc tgtgacctca tgtgctgtgg ccgtggctac aacacacacc
45421 agtacgcccg ggtgtggcag tgcaactgca aattccactg gtgctgctac gtcaagtgta
45481 acacgtgcag cgagcgcacg gagatgtata cgtgcaagtg aatgcggtca caggtcagat
45541 cacaggcagg atacagtttc cctgcaggcc actgcctgga tgctcacagg gaaagaacca
45601 cagaagcact gtccttgtct tttctgctga ggggggaggg gtattctggg tttcctgcag
45661 actcccgtgg gaagcatctc tcagaggccc gcccattctt ctccacatgg atgctgctca
45721 gccaccctcc cccagacacc gcccgagcct ctccagggct ggaacaaagt tttctacggc

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

   1.  Logan, C. Y. and Nusse, R. (2004) The Wnt signaling pathway in development and disease, Annu. Rev. Cell Dev. Biol. 20, 781-810.

   2.  Miller, J. R. (2002) The Wnts, Genome Biol. 3, REVIEWS3001.

   3.  Willert, K., Brown, J. D., Danenberg, E., Duncan, A. W., Weissman, I. L., Reya, T., Yates, J. R., III, and Nusse, R. (2003) Wnt proteins are lipid-modified and can act as stem cell growth factors, Nature 423, 448-452.

   4.  Mason, J. O., Kitajewski, J., and Varmus, H. E. (1992) Mutational analysis of mouse Wnt-1 identifies two temperature-sensitive alleles and attributes of Wnt-1 protein essential for transformation of a mammary cell line, Mol. Biol. Cell 3, 521-533.

   5.  Gavin, B. J., McMahon, J. A., and McMahon, A. P. (1990) Expression of multiple novel Wnt-1/int-1-related genes during fetal and adult mouse development, Genes Dev. 4, 2319-2332.

   6.  Parr, B. A. and McMahon, A. P. (1998) Sexually dimorphic development of the mammalian reproductive tract requires Wnt-7a, Nature 395, 707-710.

   7.  Parr, B. A., Shea, M. J., Vassileva, G., and McMahon, A. P. (1993) Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds, Development 119, 247-261.

   8.  Hall, A. C., Lucas, F. R., and Salinas, P. C. (2000) Axonal remodeling and synaptic differentiation in the cerebellum is regulated by WNT-7a signaling, Cell 100, 525-535.

   9.  Van Leeuwen F., Samos, C. H., and Nusse, R. (1994) Biological activity of soluble wingless protein in cultured Drosophila imaginal disc cells, Nature 368, 342-344.

 10.  Shibamoto, S., Higano, K., Takada, R., Ito, F., Takeichi, M., and Takada, S. (1998) Cytoskeletal reorganization by soluble Wnt-3a protein signalling, Genes Cells 3, 659-670.

 11.  Bradley, R. S. and Brown, A. M. (1990) The proto-oncogene int-1 encodes a secreted protein associated with the extracellular matrix, EMBO J. 9, 1569-1575.

 12.  Reichsman, F., Smith, L., and Cumberledge, S. (1996) Glycosaminoglycans can modulate extracellular localization of the wingless protein and promote signal transduction, J. Cell Biol. 135, 819-827.

 13.  Bejsovec, A. and Wieschaus, E. (1995) Signaling activities of the Drosophila wingless gene are separately mutable and appear to be transduced at the cell surface, Genetics 139, 309-320.

 14.  Moline, M. M., Southern, C., and Bejsovec, A. (1999) Directionality of wingless protein transport influences epidermal patterning in the Drosophila embryo, Development 126, 4375-4384.

 15.  Yang, Y. (2003) Wnts and wing: Wnt signaling in vertebrate limb development and musculoskeletal morphogenesis, Birth Defects Res. C. Embryo. Today 69, 305-317.

 16.  Mariani, F. V. and Martin, G. R. (2003) Deciphering skeletal patterning: clues from the limb, Nature 423, 319-325.

 17.  Parr, B. A. and McMahon, A. P. (1995) Dorsalizing signal Wnt-7a required for normal polarity of D-V and A-P axes of mouse limb, Nature 374, 350-353.

 18.  Miller, C. and Sassoon, D. A. (1998) Wnt-7a maintains appropriate uterine patterning during the development of the mouse female reproductive tract, Development 125, 3201-3211.

 19.  Woods, C. G., Stricker, S., Seemann, P., Stern, R., Cox, J., Sherridan, E., Roberts, E., Springell, K., Scott, S., Karbani, G., Sharif, S. M., Toomes, C., Bond, J., Kumar, D., Al-Gazali, L., and Mundlos, S. (2006) Mutations in WNT7A cause a range of limb malformations, including Fuhrmann syndrome and Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome, Am. J. Hum. Genet. 79, 402-408.

 20.  Cygan, J. A., Johnson, R. L., and McMahon, A. P. (1997) Novel regulatory interactions revealed by studies of murine limb pattern in Wnt-7a and En-1 mutants, Development 124, 5021-5032.

 21.  Riddle, R. D., Ensini, M., Nelson, C., Tsuchida, T., Jessell, T. M., and Tabin, C. (1995) Induction of the LIM homeobox gene Lmx1 by WNT7a establishes dorsoventral pattern in the vertebrate limb, Cell 83, 631-640.

 22.  Chen, H., Lun, Y., Ovchinnikov, D., Kokubo, H., Oberg, K. C., Pepicelli, C. V., Gan, L., Lee, B., and Johnson, R. L. (1998) Limb and kidney defects in Lmx1b mutant mice suggest an involvement of LMX1B in human nail patella syndrome, Nat. Genet. 19, 51-55.

 23.  Soshnikova, N., Zechner, D., Huelsken, J., Mishina, Y., Behringer, R. R., Taketo, M. M., Crenshaw, E. B., III, and Birchmeier, W. (2003) Genetic interaction between Wnt/beta-catenin and BMP receptor signaling during formation of the AER and the dorsal-ventral axis in the limb, Genes Dev. 17, 1963-1968.

 24.  Adamska, M., Billi, A. C., Cheek, S., and Meisler, M. H. (2005) Genetic interaction between Wnt7a and Lrp6 during patterning of dorsal and posterior structures of the mouse limb, Dev. Dyn. 233, 368-372.

 25.  Adamska, M., MacDonald, B. T., Sarmast, Z. H., Oliver, E. R., and Meisler, M. H. (2004) En1 and Wnt7a interact with Dkk1 during limb development in the mouse, Dev. Biol. 272, 134-144.