Phenotypic Mutation 'Joker' (pdf version)
AlleleJoker
Mutation Type critical splice acceptor site (2 bp from exon)
Chromosome10
Coordinate77,549,849 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Itgb2
Gene Name integrin beta 2
Synonym(s) Mac-1 beta, Cd18, 2E6
Chromosomal Location 77,530,252-77,565,708 bp (+)
MGI Phenotype Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis.
Accession Number

NCBI RefSeq: NM_008404; MGI: 96611

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000000299 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
EGF_like 535 574 6.81e1 SMART
Pfam:EGF_2 582 612 1.6e0 PFAM
Pfam:Integrin_B_tail 622 701 2e-14 PFAM
transmembrane domain 702 724 N/A INTRINSIC
Pfam:Integrin_b_cyt 725 770 3.8e-14 PFAM
Phenotypic Category decrease in NK cell response, hematopoietic system, immune system
Penetrance 100% 
Alleles Listed at MGI

All alleles(3) : Targeted, knock-out(2) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.15
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.76
IGL01104:Itgb2 APN 10 77547194 missense probably damaging 1.00
IGL01111:Itgb2 APN 10 77542000 missense possibly damaging 0.80
IGL01574:Itgb2 APN 10 77557964 missense probably damaging 1.00
IGL02087:Itgb2 APN 10 77559696 missense probably damaging 0.99
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.95
newhome UTSW 10 77559681 missense probably benign 0.00
nibbler UTSW 10 77561216 critical splice donor site probably null
R0217:Itgb2 UTSW 10 77548536 splice acceptor site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense probably benign 0.06
R1542:Itgb2 UTSW 10 77559486 missense probably benign 0.00
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.71
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense possibly damaging 0.49
R4352:Itgb2 UTSW 10 77556167 missense probably benign 0.10
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4600:Itgb2 UTSW 10 77546115 missense probably benign
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4685:Itgb2 UTSW 10 77550103 unclassified probably null
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice, Embryos, Sperm, gDNA
MMRRC Submission 016138-UCD
Last Updated 08/13/2017 4:02 PM by Diantha La Vine
Record Created unknown
Record Posted 12/29/2010
Phenotypic Description

The Joker phenotype was first identified as an NK cell maturation defect on the jinx mutant background (1). The Jinx phenotype was ultimately ascribed to a mutation in Unc13d. Jinx mutant mice exhibit defects in NK cell degranulation, and the Joker phenotype was detected fortuitously during an analysis of jinx NK cell maturation. NK cells became arrested at the CD27+CD11b- stage in some jinx mutants, while in others they matured normally. The phenotype was attributed to a genetic lesion which segregated in Mendelian ratios separately from the jinx genotype, and was termed Joker.

 

Homozygous Joker NK cells expressed no CD11b, while heterozygotes expressed CD11b at a level intermediate between wild type and homozygous mice, indicating that the Joker allele is semidominant or that the wild type allele is haploinsufficient (Figure 1). CD11a and CD11c were similarly affected. Compared to wild type frequencies of NK cells, a significant increase in NK cell frequency was observed in homozygous Joker bone marrow, liver, and spleen; a similar non-statistically significant trend was observed for NK cells in blood and lymph node (Figure 2).  Analysis of bone marrow NK cell maturation by flow cytometric measurements of the expression of a variety of stage-specific markers demonstrated that c-kit+ NK cells, a relatively mature NK cell population, accumulate in Joker homozygotes and account for the increase in NK cell frequency in the bone marrow (Figure 3).  The expression of CD49b β1 integrin, CD27, NK1.1 and CD43 was not affected in bone marrow, spleen, lymph node, or liver (Figure 3).  In addition, the expression of activating receptors NKp46, Ly49H, Ly49D, NKG2D, and inhibitory receptors Ly49C/I, Ly49F, Ly49G2, Ly49A, NKG2A, was unaffected in Joker homozygotes.

 

With regard to their function, reduced percentages of homozygous Joker splenic NK cells produced interferon (IFN)-γ upon stimulation with antibodies against Ly49D, NK1.1, or NKp46, or with YAC-1 tumor cells, relative to wild type NK cells.  NK cell degranulation was impaired in response to NK1.1 activation and YAC-1 cell exposure.  However, IFN-γ production by Joker NK cells was normal in response to stimulation with PMA/ionomycin, IL-12, and IL-18.  The hyporesponsivness of homozygous Joker NK cells was cell-intrinsic (Figure 4).

 

TAP1-deficient NK cell targets injected into Joker mice were killed less efficiently than those injected into wild type mice (Figure 5) (In Vivo NK Cell and CD8+ T Cell Cytotoxicity Screen).  However, the phenotype was weak when compared to the total absence of rejection observed in Tap1-/- mice.  Thus, NK cell missing-self recognition was partially impaired in Joker mice.

 

Joker mice displayed normal resistance to mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen), and produced normal amounts of serum IFN-γ, IL-12p70, and IL-12p40 36 to 38 hours post-infection.

 

Joker mice exhibited normal lymphocyte counts in spleen, liver, bone marrow, and blood. 

Nature of Mutation
The Joker mutation was mapped to Chromosome 10, and corresponds to an A to T transversion in the acceptor splice site of intron 6 (TCCCAG->TCCCTG) in the Itgb2 gene (position 19597 of Itgb2 genomic DNA sequence NC_000076). The mutation results in a complete deletion of the 155 nucleotide exon 7, but preserves the reading frame following the deletion.  Itgb2 contains 16 exons.
 

      <--exon 6   <--intron 6 exon 7-->   exon 8--> <--exon 16

18432 GCATGTCCG………CTTCTTCCCAG GAGGAAATT………GACTACCCA……GAAAGCTAG 34893

244   -A--C--P-               -E--E--I-…  -D--Y--P-……-E--S--*  769      

       correct                 deleted          correct 

 
The acceptor splice site of intron 6, which is destroyed by the Joker mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.
Protein Prediction

 

Figure 6. Domain structure of a and b integrins. Some a subunits do not contain an I domain. The b-propeller and I-like domains make numerous contacts in the native integrin dimer. The approximate location of the Joker deletion within the I-like domain is indicated in red. HD, hybrid domain.

The Itgb2 gene encodes the integrin β2 protein (also called CD18), which forms noncovalently linked dimers with integrin α subunits to form functional integrin receptors. The extracellular domains of integrin α and β subunits are >940 and >640 residues, respectively, but the intracellular domains are much shorter, about 50 residues. The shape of the integrin receptor extracellular domain, as determined by electron microscopy, is a globular ligand-binding headpiece connected to two long stalk regions, connected to the transmembrane and C-terminal cytoplasmic domains.

 

Integrin β2 is a cysteine-rich single pass transmembrane protein with six N-linked extracellular glycosylation sites (Figure 6) [reviewed in (2)]. Of the total 769 amino acids, 700 N-terminal residues (including a 23 amino acid signal peptide) comprise the extracellular domain (3). A region of 23 hydrophobic amino acids forms the transmembrane domain, followed by a cytoplasmic domain containing 46 amino acids at the C-terminus (3). All 56 cysteine residues in integrin β2 are located in the extracellular domain, and are conserved in the β1 and β3 subunits (3). These cysteine residues form intrachain disulfide bonds which provide the protein with a rigid structure.

 

The N-terminal cysteine-rich region (residues ~1-50) of the integrin β2 extracellular domain is called a PSI (plexins, semaphorins, integrins) domain, and shares homology with the membrane proteins plexins, semaphorins and the c-met receptor. Residues ~100-340 contain a von Willebrand factor-type A domain of 241 amino acids, which is referred to as the inserted (I) domain in α subunits and I-like domain in β subunits. I domains serve as the ligand-binding sites in integrins, and when they are not present in the α subunit, the I-like domain of the β subunit plays this role. The I-like domain has a three dimensional structure similar to that of I domains, with six major α helices and a β sheet composed of five parallel and one anti-parallel β strand. There is a large interface between the β-propeller domain of the α subunit (containing the I domain) and the I-like domain of the β subunit (4), and evidence suggests that the I-like domain regulates the conformation of the I domain when both are present in the integrin (5). Ligand binding depends on the integrity of the metal ion-dependent adhesion site (MIDAS), a part of I and I-like domains, which binds to divalent cations and coordinates to a glutamine or aspartate residue in the ligand. A DXSXS sequence, a key metal-binding motif of the MIDAS, is found in both I and I-like domains. The I-like domain is a hotspot for point mutations causing leukocyte adhesion deficiency as a result of a failure of the β2 subunit to associate with α subunits or bind ligands (6) (see Background). The hybrid domain is an immunoglobulin-like β-sandwich domain formed from approximately 100 amino acids on either side of the I-like domain; it forms extensive contacts with the I-like domain that may help to regulate the global conformation and therefore the activation state of the integrin dimer. The C-terminal portion of the extracellular domain is the “stalk” region, which contains four EGF-like domains (integrin-EGF, I-EGF) that form a rigid 3D structure (residues 435-600), and a tail domain connecting it to the membrane. Please refer to reference (7) for an excellent review of integrin receptor extracellular domains and structure.

 

Electron microscopic studies, crystallographic and NMR analyses strongly suggest that integrin ectodomains exist in a bent conformation in the latent, low-affinity state (Figure 7; PDB 1JV2) (4;8;9). Destabilization of the interface between the α and β legs in the tailpiece leads to destabilization of the bent conformation and “switchblade-like” opening of the structure to an open high-affinity conformation where ligand may bind. On the cell surface, integrins equilibrate between the low- and high-affinity state, an equilibrium which may be shifted by the presence of intracellular activators or extracellular ligands (9).

 

The Joker mutation results in deletion of 52 amino acids (residues 247-298) from the C-terminal half of the I-like domain of integrin β2. The mutant protein is not detectable with cell surface or intracellular antibody staining, but whether this is due to absence of the protein or the inability of the antibody to recognize a misfolded epitope remains unclear. The lack of CD11a, CD11b, and CD11c staining of Joker cells strongly suggests that no β2-containing integrin receptors are expressed in these mice.

Expression/Localization

Integrin β2 is expression is restricted to cells of the leukocyte lineage (10). Leukocyte subtypes express one or more β2-containing integrins, which may be found at the plasma membrane and in subcellular storage granules (11;12).  Integrin activation can result in the translocation of β2-containing integrins to the cell surface (12).

Background

Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins, including β2-integrins, link to and regulate the actin cytoskeleton. Their ligands are diverse, but most possess a short peptide motif containing an acidic residue (aspartate or glutamate) positioned in a flexible loop. There are 24 distinct integrins formed by a combination of α and β subunits, and those containing the β2 subunit are leukocyte-specific [reviewed in (10)]. Each leukocyte class expresses a distinct pattern of integrins that changes in functional state, density and localization in response to intra- and extracellular cues, including protein modifications (e.g. phosphorylation), cytokines, chemokines, and other cell adhesion molecules. However, all leukocytes express one or more β2-containing integrin. The β2-containing integrins are αLβ2 (CD11aCD18; also called leukocyte function-associated antigen 1, LFA-1), αMβ2 (CD11bCD18; also called MAC-1), αXβ2 (CD11cCD18; also called p150,95) and αDβ2 (CD11dCD18). The CD11/CD18 integrins are referenced collectively as the “leukocyte” integrins, and mediate leukocyte adhesion during inflammatory responses to infections and also during wound repair. Integrin αDβ2 is the most recently identified member of the β2 integrins, and is expressed on most human leukocytes, including neutrophils,monocytes, lymphocytes, and eosinophils (13;14).  Based on its upregulation upon cell stimulation with phorbol ester, the Ca2+ ionophore A23187, or IL-5, αDβ2 has been suggested to contribute to eosinophil adhesion during states of chronic inflammation (14).

 

Figure 8. Activation and signaling of integrin receptors. Left, Schematic of open, high-affinity conformation of an integrin receptor consisting of α and β integrin subunits. The I domain of the α subunit typically contains the ligand-binding site of the integrin, and its conformation is regulated by the β subunit I-like domain to which it binds directly. Center, Inside-out signaling, also called priming, occurs when intracellular proteins such as talin bind to the tails of β integrins, clustering the receptors at the cell membrane and thereby increasing avidity for ligand. (Kindlin-1 and Kindlin-2 proteins have also been found to interact with and activate integrins from inside the cell.) Right, Integrin ligands, also known as counter-receptors, activate integrins during outside-in signaling and induce clustering that permits the recruitment of signaling molecules to the cytoplasmic face of the receptor.

Leukocytes circulate in the blood in a quiescent state of low adhesiveness, becoming activated and migrating into tissues during microbial invasion in order to defend against infection. The β2-containing integrins are thus inactive when leukocytes are in a resting state, and must be rapidly activated during infection to mediate leukocyte adhesion to various cell types such as endothelial cells of vessel walls and antigen-presenting cells. Integrins transmit signals bidirectionally across the plasma membrane. “Outside-in” signaling occurs when ligands bind to integrins, and serves to mediate adhesion and to initiate downstream signaling (Figure 8). Ligand binding induces the clustering of integrins on the cell surface and enables the recruitment of signaling molecules to the cytoplasmic face of the receptor. β2 integrin-mediated adhesion occurs through binding to a variety of ligands (Table 1), which are inducibly expressed on epithelial cells, endothelial cells and cells of the immune system. These molecules are themselves transmembrane proteins and are therefore sometimes referred to as counter-receptors.

 

Table 1. β2 integrin ligands*

 

Integrin

Ligand

Reference

CD11a/CD18 (αLβ2, LFA-1)

Intercellular adhesion molecule 1 (ICAM-1)

(15)

 

ICAM-2

(16)

 

ICAM-3

(17;18)

 

ICAM-4

(19)

 

ICAM-5

(20)

 

Junctional adhesion molecule A (JAM-1)

(21)

CD11b/CD18 (αMβ2, MAC-1)

ICAM-1

(22)

 

ICAM-2

(23)

 

ICAM-4

(19)

 

iC3b

(24)

 

fibrinogen

(25)

 

heparin

(26)

 

low-density lipoprotein receptor-relatedprotein (LRP)

(27)

 

Matrix metalloproteinase 9 (MMP9)

(28)

CD11c/CD18 (αXβ2)

ICAM-4

(29)

 

iC3b

(30)

 

fibrinogen

(31)

 

heparin

(26;32)

CD11d/CD18 (αDβ2)

ICAM-3

(13)

 

VCAM-1

(14)

*Not a comprehensive listing

 

“Inside-out” signaling primes integrins for ligand binding. The adhesive state of integrins may be modulated by conformational changes in the integrin itself, or possibly by clustering of integrins on the cell surface to increase avidity (7). The intracellular domain of the β2 chain has been shown to influence integrin adhesive activity in the case of LFA-1 (33;34). How this process is regulated is largely unknown, but Rho family GTPases and the cytoskeletal protein talin have been shown to play a role. Knockdown of the leukocyte-specific inhibitory RhoH in peripheral blood lymphocytes results in a constitutively adherent phenotype towards ICAM-1, demonstrating that RhoH promotes the nonadhesive state of LFA-1 (integrin αLβ2) (35). Conversely, knockdown of talin impairs TCR-induced adhesion to ICAM-1 (36). Another Rho GTPase, RhoA, promotes neutrophil adhesion through β2 integrin (37).

 

Two integrin β2 mutant mice have been developed. One strain contains a hypomorphic allele (Itgb2tm1Bay) of integrin β2 and expresses 2% or 16% of wild type protein levels in granulocytes in the resting or activated state, respectively (38). These animals exhibit elevated total numbers of leukocytes, including granulocytes and lymphocytes, as well as an impaired inflammatory response to intraperitoneal injection of thioglycolate medium (slightly fewer numbers of neutrophils migrate into the peritoneal cavity). When this mutation was backcrossed onto the PL/J inbred strain, homozygous mice developed spontaneous chronic inflammatory skin disease which did not depend on bacterial or fungal infections (39).

 

The second integrin β2 mutant strain contains a null allele (Itgb2tm2Bay), and exhibits a phenotype very similar to that of human patients with leukocyte adhesion deficiency. 10% to 40% of newborn CD18 null mice die perinatally, with the surviving mice developing progressive perioral soft tissue swelling, facial alopecia, reddening of the skin, and extended facial and submandibular ulcerative dermatitis at 3 months of age (40). The dermis under skin lesions contains a predominantly mononuclear inflammatory cell infiltrate containing lymphocytes and histiocytes, but very few neutrophils. CD18-/- mice have increased serum immunoglobulin levels (IgG, IgG1, IgG2a, IgG2b, IgG3, IgM, IgA), lymphadenopathy and splenomegaly. The number of circulating leukocytes in CD18 null mice is increased up to six-fold compared to wild type littermates, primarily due to elevated numbers of neutrophils. Interestingly, although CD18 null mice display increased susceptibility to intraperitoneal infection with Streptococcus pneumoniae, similar numbers of neutrophils migrate into the peritoneal cavity in response to infection as observed in wild type mice. In a dermatitis model induced by application of 2% dinitrofluorobenzene to the ears, a severe toxic response was observed in both CD18 null and wild type mice. However, mutant neutrophils could not migrate into the dermis due to a failure to attach to the endothelial lining of venules, preventing extravasation. CD18-/- T cells fail to proliferate in response to TCR stimulation with either allogeneic wild type splenocytes, or staphylococcal enterotoxin A.

 

Humans with absent or reduced levels of integrin β2 on the surface of leukocytes develop leukocyte adhesion deficiency, type I (LAD, OMIM #116920), an autosomal recessive disorder characterized by leukocytosis (especially neutrophilia), failure to recruit leukocytes to sites of infection, recurring bacterial and fungal infections involving the skin and mucosa, impaired wound healing, and lack of pus formation. Patients also show a delayed separation of the umbilical cord at birth. These deficiencies are due to impaired adhesive function and signaling of leukocytes. LAD is associated with the lack of LFA-1, MAC-1, αXβ2, but not αDβ2. The severity of the disease corresponds to the levels of functional β2-containing integrins expressed on the cell surface; most patients with no detectable CD18 expression die within the first 5 years of life unless treated by bone marrow transplantation (41).

Putative Mechanism

Joker mice display a phenotype distinct from that of the CD18 null or hypomorphic mutant, and from humans with LAD. In particular, Joker mice do not develop the dermatitis or facial/submandibular inflammation observed in CD18-/- mice. No spontaneous infections have been observed in Joker mice, as they are in the CD18 null mutant and in LAD patients. The Joker phenotype is surprising because, from the lack of CD18, CD11a, CD11b and CD11c staining, it appears that no β2-containing integrins are expressed on Joker leukocytes and a phenotype more similar to that of the null mutant might be predicted. Strain differences may explain the differences in phenotypes, a hypothesis supported by the finding that no inflammatory disease occurs when the hypomorphic Itgb2tm1Baymutant allele is crossed onto a C57BL/6J background (39). Compensatory mechanisms may also play a role in moderating the phenotype of Joker mice. Indeed, although neutrophil migration into the peritoneum in response to intraperitoneal infection with S. pneumoniae is preserved in CD18 null mice, treatment of wild type mice with function blocking antibodies against β2 integrins inhibits neutrophil accumulation under similar conditions, suggesting that a lifelong deficiency can induce compensatory changes in mutant mice (42;43).

 

Although unlikely based on the complete lack of anti-CD18 staining on Joker cells, it is possible that the protein encoded by Itgb2Joker is hypomorphic and retains some function. Human patients with integrin β2 expression levels at 2%-16% of normal have a much milder form of LAD, and the same may be true in Joker mutants. The Joker mutation results in deletion of 52 amino acids (residues 247-298) from the C-terminal half of the I-like domain of integrin β2. The deletion eliminates the fourth β strand, as well as most of the loop connecting it to the fourth α helix. This loop includes an aspartic acid residue which helps to coordinate metal ion binding to the MIDAS. The Joker mutation may therefore impair ligand binding to integrins in two ways. Divalent cations are universally required for ligand binding by integrins, and the deletion of a metal-coordinating residue is likely to compromise ligand binding. Because the I-like domain interfaces with and regulates the conformation of the I domain of the α subunit, the deletion caused by the Joker mutation may also interfere with ligand binding by preventing interactions between I and I-like domains. It remains possible that the mutation simply destabilizes the protein and results in its degradation. Since the phenotype of Joker mice suggests some integrin function is retained, it may be that ligand binding and/or protein stability are partially impaired by the mutation, and that antibody staining fails to detect integrin expression due to epitope masking.

 

Another other surprising feature of the Joker phenotype is the normal resistance to infection with MCMV. Lack of β2 integrin expression might be expected to impair the function of cytotoxic T lymphocytes and NK cells, which are essential for the control of MCMV. Function blocking anti-CD18 antibodies inhibit NK cell cytolytic activity, and clones of NK cells derived from LAD patients have been shown to be defective in cytolytic function (44;45). Additionally, CD8+ T cells lacking LFA-1 (from a CD11a mutant) fail to proliferate in response to or kill target allogeneic splenocytes (46). However, human patients with LAD are not known to have increased susceptibility to viral infections, and a study of the NK cell functions of two LAD patients with a complete lack of CD18 expression demonstrated normal expression levels of NK cell activating receptors, and normal IFNγ production, cytolytic activity, and induction of dendritic cell maturation by IL-2-activated polyclonal NK cells (47).

 

Hyporesponsive NK cells raised in a MHC class I-deficient environment are fully functional to control MCMV infection, although they are unable to reject MHC class I-negative target cells (48;49).  Consistent with these findings, Joker mice cleared MCMV infection as efficiently as wild type mice.  These data suggest that the inflammatory environment generated during the course of a viral infection triggers alternative pathways of NK cell activation that overcome the hyporesponsiveness of NK cells when they originate from a β2 integrin- or a MHC class I-deficient environment.

Primers Primers cannot be located by automatic search.
Genotyping
Joker genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
 
Primers
Joker(F): 5’- AGATGTGTTTCTGTTCTTACCTCATACTGCTG -3’
Joker(R): 5’- CTCTTGTACATGTTATCCTCCAGGTGGCAG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 58°C             0:15
4) 72°C             0:30
5) repeat steps (2-4) 39X
6) 72°C             7:00
7) 4°C              ∞
 
The following sequence of 606 nucleotides (from Genbank genomic region NC_000076 for linear genomic sequence of Itgb2) is amplified:
19136                                                             agatg
19141 tgtttctgtt cttacctcat actgctgcag ggcatgctgg gagttgacgg ctttggcact
19201 tccttggcac tggattgggg ctctatcttc ctctgtctgt ctgtctgtct gtctgtctgt
19261 ctgtctgtct gtctgtcgta tctggggggt gtctgtttgt ttccatgttt ctgtctctct
19321 ttatatatat atatctgtct ctctctttat ctctatctgt ttttatgtct tgttgtctct
19381 gtctctatgt ctctgtgtct ctatcactct gtgtgtgtgt gtctctttgt atgtatgtct
19441 ctgtctgttt gtctgtctct ttctctgtct ttctatctct ctgtgtctct ctttctgtct
19501 ctgtctctct cactctccct cacacacaca caactcttct cccctgaggg ccccatgggg
19561 aaaccaaggc aggtaacccc tggatgcctt cttcccagga ggaaattggc tggcgcaatg
19621 tcacgaggct gctggtgttt gccacagacg atggcttcca ctttgctggt gatggcaaac
19681 tgggtgccat cctgaccccc aatgatggcc gctgccacct ggaggataac atgtacaaga
19741 g
 
Primer binding sites are underlined; the mutated A is highlighted in red.
References
 35.  Cherry, L. K., Li, X., Schwab, P., Lim, B., and Klickstein, L. B. (2004) RhoH is required to maintain the integrin LFA-1 in a nonadhesive state on lymphocytes, Nat. Immunol. 5, 961-967.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsKarine Crozat, Sophie Ugolini, Celine Eidenschenk, Bruce Beutler
Edit History
07/14/2011 1:52 PM (current)
05/04/2011 10:40 AM
01/06/2011 11:03 AM
01/06/2011 10:56 AM
01/05/2011 1:22 PM
01/04/2011 3:41 PM
01/04/2011 3:30 PM
01/04/2011 3:13 PM
01/04/2011 2:57 PM
12/29/2010 5:41 PM
12/29/2010 5:39 PM
12/29/2010 5:37 PM
12/29/2010 5:35 PM
12/29/2010 5:32 PM
12/29/2010 5:21 PM
12/29/2010 5:20 PM
12/29/2010 5:17 PM
12/29/2010 5:10 PM