Phenotypic Mutation 'tumormouse' (pdf version)
Alleletumormouse
Mutation Type nonsense
Chromosome9
Coordinate45,006,150 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Cd3e
Gene Name CD3 antigen, epsilon polypeptide
Synonym(s) T3e, CD3, CD3epsilon
Chromosomal Location 44,998,743-45,009,590 bp (-)
MGI Phenotype Mice homozygous null for this mutation lack peripherial T cells and have a block of thymocyte development at the DN3 stage.
Accession Number

NCBI RefSeq: NM_007648; MGI: 88332

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Y84* in Ensembl: ENSMUSP00000099896 (fasta)
Gene Model not available
PDB Structure
CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct [SOLUTION NMR]
CD3 EPSILON AND DELTA ECTODOMAIN FRAGMENT COMPLEX IN SINGLE-CHAIN CONSTRUCT [SOLUTION NMR]
Mouse CD3epsilon Cytoplasmic Tail [SOLUTION NMR]
Crystal structure of mouse cd3epsilon in complex with antibody 2C11 Fab [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 33 90 3.79e-13 SMART
transmembrane domain 111 133 N/A INTRINSIC
ITAM 167 187 2.96e-4 SMART
Phenotypic Category hematopoietic system, immune system
Penetrance 100% 
Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(4) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0504:Cd3e UTSW 9 45002254 missense probably benign
R3237:Cd3e UTSW 9 45002310 nonsense probably null
R6054:Cd3e UTSW 9 45002161 missense possibly damaging 0.87
X0025:Cd3e UTSW 9 45000976 splice donor site probably null
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
MMRRC Submission 030345-UCD
Last Updated 12/30/2016 2:42 PM by Katherine Timer
Record Created unknown
Record Posted 09/13/2007
Phenotypic Description
The tumormouse phenotype was identified in a screen for allogeneic sterility. G3 mice with homozygous ENU-induced mutations were injected intraperitoneally with L-929 fibroblasts of C3H background in order to pre-immunize against C3H alloreactive determinants. One animal developed an intra-abdominal tumor consisting of L-929 cells. The mutant phenotype was termed tumormouse.
 
Further analysis revealed that tumormouse animals have very small thymi with abnormal structure and no peripheral T cells. tumormouse mutants have no CD4+CD8+ double positive (DP) T cells, and thymocyte development was found to be arrested at the CD44+CD25- double negative (DN) 3 stage. Compared to wild type, tumormouse thymocytes display increased levels of apoptosis. B cells, macrophages and NK cells are found at normal levels in the periphery in tumormouse animals.
 
Some tumormouse animals older than 9 months of age appear to experience epileptic-like seizures.

 

Nature of Mutation
The tumormouse mutation was mapped to Chromosome 9 and corresponds to a C to A transversion at position ­­­330 of the Cd3e transcript, in exon 5 of 8 total exons.
 
313 GGCTACTACGTCTGCTACACACCAGCCTCAAAT
79  -G--Y--Y--V--C--Y--T--P--A--S--N-
 
The mutated nucleotide is indicated in red lettering, and creates a premature stop codon in place of tyrosine 84 resulting in deletion of 106 amino acids from the C terminus of the protein.
Protein Prediction
Figure 1. Structure of CD3ε.  A, Domain structure of the CD3ε protein. B, Chimera UCSF 3D structure of the extracellular domain of CD3ε based on PDB ID 1XIW. The tumormouse mutation creates a premature stop codon in place of tyrosine 84 resulting in deletion of 106 amino acids from the C terminus of the protein. Click on the 3D structure to view it rotate.
Figure 2. Crystal structure of the CD3ε-CD3δ extracellular domains bound to the UCHT1 antibody. CD3ε is in blue, CD3d is in cyan, while the heavy and light chains of UCHT1 are in orange and pink respectively. β-strands are represented with flat arrows and α-helices are shown as coils. The location of the tumormouse mutation is indicated in red. UCSF Chimera structure is based on PDB 1XIW, Arnett et al, Proc. Natl. Acad. Sci. U.S.A. 101, 16268-16273 (2004). Click on the 3D structure to view it rotate.
CD3e encodes a 189-amino acid protein, of which the N-terminal 88 amino acids are extracellular, followed by a 26-amino acid transmembrane domain, and a 65-amino acid cytoplasmic region (Figure 1A) (1). CD3ε belongs to the immunoglobulin superfamily and its extracellular domain adopts a similar fold, with an eight-stranded β-sheet bilayer (Figure 1B) (1;2). While trimeric transmembrane interactions (CD3ε-CD3δ-TCRβ and CD3ε-CD3δ-TCRα) are essential for the assembly and surface expression of TCR/CD3 complexes (3), extracellular interactions enhance these interactions and are mediated by residues conserved among mammals (2). The crystal structure of CD3ε bound to the UCHT1 antibody suggests that trimeric interactions (CD3ε-CD3δ-TCRβ and CD3ε-CD3δ-TCRα) result in a receptor formed from a tight bundle, perhaps no wider than the TCR alone (2) (Figure 2; PDB ID 1XIW).
 
The cytoplasmic domain of CD3ε contains a basic amino acid-rich region (4), a proline-rich region (5), and an immunoreceptor tyrosine-based activation motif (ITAM) (6). These motifs mediate interactions with downstream signaling molecules.
 
The tumormouse mutation replaces tyrosine 84 with a premature stop codon and truncates the CD3ε chain in the extracellular domain of the protein. The truncation results in a CD3ε null animal.
Expression/Localization
Cd3ε is expressed in immature thymocytes and T cells, and localizes to the plasma membrane.
Background
T cell receptors (TCRs) are responsible for recognition of MHC/antigen ligands, with their different specificities generated by rearrangement of germline V, D, and J segments during development. The complete TCR consists of a complex including TCR α/β or γ/δ chains, several invariant CD3 chains, and ζ chains (see allia) (7). CD3γ, CD3δ and CD3ε constitute the three types of CD3 chains, and combine to form TCRs with stoichiometry TCRαβ or TCRγδ /CD3γε/CD3δε/ζζ.
 
Development of thymocytes into mature T cells occurs in the thymus, where thymocytes follow a program of differentiation characterized by expression of distinct combinations of cell surface proteins including CD4, CD8, CD44 and CD25. The most immature thymocytes are CD4-CD8- double negative (DN). This group can be further subdivided into 4 groups that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4). During this process, expression of pre-TCRα (pTα), TCRα, TCRβ and CD3 proteins is activated in temporal sequence to promote T cell development. Transcripts of all the CD3 chains are expressed from the earliest identifiable thymic precursor stage (8). Studies of CD3ε-deficient mice demonstrate that CD3ε specifically contributes to formation of a pre-TCR complex with TCRβ and pTα at the CD44-CD25+ DN3 stage, and these animals have no mature T cells (9-11). Interestingly, one group reported that CD3ε null thymocytes were severely, but not completely arrested at the DN3 stage, suggesting that expression of the other components of the pre-TCR may assemble a partial complex that can weakly induce transition out of the DN3 stage (11).
 
Figure 3. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.
Signaling from the TCR complex is separated into the functions of ligand binding, signal transduction and tyrosine kinase activity, each of which is carried out by separate polypeptides. In particular, recognition and binding of MHC/antigen ligands is carried out by TCRαβ or TCRγδ heterodimers, CD3 chains are responsible for signal transduction, and recruited Syk and Src family members provide tyrosine kinase activity (12). Evidence indicates that crosslinking within the TCR complex is required for its activation: both bivalent anti-CD3 antibodies and multivalent MHC/antigen complexes activate T cells (12;13). Upon TCR crosslinking, signaling by the TCR complex relies on the ten ITAMs present in the CD3γ, δ, ε, and ζ chains [reviewed in (6;14)] (FIgure 3). The Src family kinases Lck and Fyn are recruited and activated, specifically phosphorylating ITAMs in CD3γ, δ, ε and ζ. These phosphorylated ITAMs then recruit ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock) and Syk, which trans- and auto-phosphorylate, forming binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. ZAP-70 and Syk may also phosphorylate the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6). These phosphorylation events lead to activation of multiple serine/threonine kinases, including MAP kinases, IκB kinases, and PKC family members, which ultimately regulate transcription factor activity.
 
In addition to the signal transduction cascade mediated by Lck and Fyn, another independent pathway involving recruitment of Nck to CD3ε may activate TCR signaling (5;15). This type of activation involves a conformational change in CD3ε (16), exposing a proline-rich region where Nck binds. Little data on the nature of the conformational change is available. Interestingly, this method of TCR complex activation does not require TCR crosslinking or tyrosine phosphorylation.
 
Recent work identified interactions between the membrane-proximal basic amino acid-rich region of CD3ε and G-protein-coupled receptor kinase 2 (GRK2) in thymocytes, which may be regulated by T cell activation and chemokines (4).
Putative Mechanism
As in other CD3ε mutants, thymocyte development arrests at the DN3 stage resulting in a complete lack of mature T cells in tumormouse mutants. The absence of mature T cells describes the condition of severe combined immunodeficiency (SCID). Several mechanisms causing SCID have been identified, including defective pre-TCR/TCR signaling. CD3ε mutations cause SCID in this way (17) (OMIM +186830). Likewise, mice deficient in VDJ recombination due to deletion of recombination activating gene-1 (Rag-1) (18) or Rag-2 (19) are devoid of T cells and contain only immature DN3 thymocytes. In addition, mutations in any of the components of DNA-dependent protein kinase (DNA-PK) (20-22), CD3δ (19) or Artemis, a DNA double-strand break repair protein (23), results in a lack of T cells. As in mice, CD3e mutations in humans lead to immunodeficiency (17), and patients with such mutations develop serious infections for which antibiotics are poorly effective (24).
 
The immune system, being capable of recognizing and destroying developing tumors, and controlling the tumorigenicity of cancer cells, plays a strong protective role against cancer. Tumors derived from immunodeficient Rag2-/- mice are more immunogenic than those derived from immunocompetent mice (25). NK cells recognize invading cells, and together with dendritic cells, prime and activate CD4+ and CD8+ T cells to eliminate neoplastic cells.  Immunotherapy using antigen-specific splenocytes confers protection from established and subsequent tumor burdens in mice (26). Tumor development in the tumormouse mutant can likely be attributed to a deficiency in ability to reject foreign cells due to lack of T cells.
Primers Primers cannot be located by automatic search.
Genotyping
Tumormouse genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. 
 
Primers for PCR amplification
Tumor(F): 5’- GGACACCTCTCTACCAAGCAAACCTCG -3’
Tumor(R): 5’- GGTAGTGGCCCTGAGTCTCTCTGGATG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 59°C             0:30
4) 68°C             1:00
5) repeat steps (2-4) 35X
6) 68°C             5:00
7) 4°C               ∞
 
Primers for sequencing
Tumor_seq(F): 5’- CGACACCCAGCGATAAGTAACTTC -3’
Tumor_seq(R): 5’- TAGACAACTCCAGGCCACACCG -3’
 
The following sequence of 678 nucleotides (from Genbank genomic region NC_000075 for linear genomic sequence of Cd3e) is amplified:
 
7093              ggacacct ctctaccaag caaacctcga cacccagcga taagtaactt
7141 cctgtaatct agttgcctct cacagcacta atttggcatt tgtgaaactt ccctagagtt
7201 tccccttcaa tccccttccc ttttcttctt ttcccagaat acaaagtctc catctcagga
7261 accagtgtag agttgacgtg ccctctagac agtgacgaga acttaaaatg ggaaaaaaat
7321 ggccaagagc tgcctcagaa gcatgataag cacctggtgc tccaggattt ctcggaagtc
7381 gaggacagtg gctactacgt ctgctacaca ccagcctcaa ataaaaacac gtacttgtac
7441 ctgaaagctc gaggtaactc gggctcctcc caaatcagcc ttctcaagaa ccctatcatc
7501 tctcagctgc tcctgcactc caccccaggt tctccggggc cacacattca gtattttctg
7561 aaaaatagac tgcacggtgt ggcctggagt tgtctaggta attccattgg taccaggtgt
7621 acaacagcaa cttcccacag atgaaggctt gggtcacctg ccttgtaacg tacccagaat
7681 caaggcttac tactatcatg agttgatggg gtcacttatt cagagaccca ttttattaca
7741 aggacatcca gagagactca gggccactac c
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is highlighted in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsXin Du, Bruce Beutler
Edit History
03/02/2011 2:34 PM (current)
09/10/2010 12:07 PM
09/10/2010 10:58 AM
09/10/2010 10:56 AM
08/30/2010 1:58 PM
07/15/2010 3:59 PM
07/15/2010 2:44 PM
02/03/2010 10:47 AM