Phenotypic Mutation 'pinkie'

• Allele: pinkie
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 27,642,346 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Rxra
• Gene Name: retinoid X receptor alpha
• Synonym(s): RXRalpha1, 9530071D11Rik, RXR alpha 1
• Chromosomal Location: 27,566,452-27,652,969 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014] ; PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Asparagine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P28700
• SMART Domains: Protein: ENSMUSP00000076491; Gene: ENSMUSG00000015846; AA Change: I273N

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	18	132	4.2e-42	PFAM
ZnF_C4	137	208	1.76e-40	SMART
Blast:HOLI	233	265	1e-8	BLAST
HOLI	275	434	1.62e-53	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000077257)
• SMART Domains: Protein: ENSMUSP00000097822; Gene: ENSMUSG00000015846; AA Change: I245N

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	1	104	1.8e-38	PFAM
ZnF_C4	109	180	1.76e-40	SMART
Blast:HOLI	205	237	1e-8	BLAST
HOLI	247	406	1.62e-53	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000100251)
• SMART Domains: Protein: ENSMUSP00000109567; Gene: ENSMUSG00000015846; AA Change: I245N

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	1	104	1.8e-38	PFAM
ZnF_C4	109	180	1.76e-40	SMART
Blast:HOLI	205	237	1e-8	BLAST
HOLI	247	406	1.62e-53	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000113934)
• SMART Domains: Protein: ENSMUSP00000133044; Gene: ENSMUSG00000015846; AA Change: I273N

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	17	132	6.5e-41	PFAM
ZnF_C4	137	208	1.76e-40	SMART
Blast:HOLI	233	265	1e-8	BLAST
HOLI	275	434	1.62e-53	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
  (Using ENSMUST00000166775)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Embryos, Sperm, gDNA
• MMRRC Submission: 012828-UCD
• Last Updated: 2017-04-11 4:44 PM by Katherine Timer
• Record Created: unknown
• Record Posted: 2007-09-19
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Xin Du, Bruce Beutler

Accession Number

NCBI RefSeq: NM_011305; MGI: 98214

Alleles Listed at MGI

All alleles(15) : Targeted, knock-out(7) Targeted, other(2) Gene trapped(5) Chemically induced(1)

Phenotypic Description

The pinkie phenotype was identified as a visible phenotype among G3 mice homozygous for mutations induced by ENU (1). The fur of pinkie mice grays prematurely, beginning on the snout as early as 5 weeks of age and spreading to the trunk (Figure 1A, B). Alopecia progresses from the caudal ventral surface to the lower back, and then to the rest of the body. By 4 months of age, pinkie mice are typically hairless, with a thin and hypopigmented appearance of the skin, often exhibiting dermatitis (Figure 1C).

 

Homozygous pinkie females develop cysts under the ventral skin at approximately 8 weeks of age, which progressively increase in size and number. The cysts have black spots on the top surface. Compared to females, males are affected with cysts less severely and onset begins later in life.

 

Some mutants develop a hunchback (dorsal kyphosis) by 1 year of age.

 

With age, pinkie mice develop “dry” eyes and corneal opacity.

 

Pinkie mice are fertile for only approximately 6 months.

 

Pinkie mice display the following immune system phenotypes: Although lymphocyte count and CD4⁺:CD8⁺ T cell ratios are normal in pinkie mice, they display a progressive impairment in T helper type 2 (Th2) antigen-specific IgG1 production following immunization with ovalbumin and alum. In vitro, naïve pinkie CD4+ T cells favor differentiation to Th1 when exposed to conditions supporting mixed Th1/Th2 differentiation. pinkie dendritic cells (DCs) produce increased levels of interleukin-12 (IL-12), regardless of TLR4 stimulation.

Nature of Mutation

The pinkie mutation was mapped to Chromosome 2, and corresponds to a T to A transversion at position 1050 of the Rxrα transcript, in exon 6 of 10 total exons.

 

1034 GACCCTGTTACCAACATCTGTCAAGCAGCAGAC

268 -D--P--V--T--N--I--C--Q--A--A--D-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of isoleucine to asparagine at residue 273 of the RXRα protein.

Protein Prediction

Figure 2. Domain structure of RXRα. ZF, Zinc finger. The location of the pinkie mutation is indicated.

Figure 3. Crystal structure of the ligand-binding domains of RARb (green) and RXRα (cyan) complexed with 9-cis retinoic acid (shown in space-filling mode in gray) and an LXXLL-containing peptide from the TRAP220 coactivator (magenta). β-strands are represented by arrows and α-helices by coils. The location of the pinkie mutation is indicated. UCSF Chimera model is based on PDB 1XDK, Pogenberg et al., J. Biol. Chem. 280, 1625-1633 (2005). Click on the 3D structure to view it rotate.

Retinoic X receptors (RXRs) and retinoic acid receptors (RARs) form heterodimers which control the transcription of target genes through binding to retinoic acid (RA) response elements (RARE). RXRα is organized into 5 conserved regions, designated A to F (2). The N-terminal A/B region contains the ligand-independent transcriptional activation function. The central C region contains the DNA binding domain, and a surface for RAR/RXR interaction. Located in the E region is the ligand-binding domain (LBD) and surfaces for RXR/RAR heterodimerization and binding of transcriptional silencing corepressors (Figure 3; PDB ID 1XDK). Binding of ligand induces a conformational change in the LBD, which allows binding of coactivators and release of corepressors (2), and is required for transactivation (3). The pinkie mutation is an isoleucine to asparagine change at position 273, located in the third α-helix of the RXRα LBD, resulting in a hypomorphic allele that retains only 10% of normal RARE- or vitamin D response element (VDRE)-dependent reporter activity upon RA or vitamin D stimulation in vitro.

Expression/Localization

RXRα is widely expressed, with abundant levels reported in skin, liver, kidney, lung, muscle, spleen, and lower levels in brain, heart, intestine and testes (4). During embryonic development, RXRα is found predominantly in the skin, liver and epithelia of the digestive system (4).

Background

RXRs belong to the nuclear receptor superfamily, and act as ligand-inducible transcription factors regulating expression of target genes involved in vertebrate morphogenesis, growth, differentiation, and tissue homeostasis [reviewed in (2)]. The RXR subfamily binds to 9-cis RA and includes RXRα, -β and -γ isoforms (4). RXRs form heterodimers with both RARs and with other nuclear receptors such as thyroid hormone (TR) and vitamin D3 (VDR) receptors (5).

 

A great many studies have undertaken to understand the physiological roles of RXRs through the generation of mice lacking RXR function [discussed in (2)]. RXRα-null mutants die as embryos between days 13.5 and 16.5 (6), likely due to cardiac failure caused by a hypoplasia of the ventricular myocardium (7). A similar myocardial defect is observed as a result of vitamin A deficiency (7). RXRα-null and vitamin A-deficient mice also display similar embryonic ocular malformations, including persistent and hyperplastic vitreous body (PHPV), closer eyelid folds, and a shortening of the ventral retina (6). In addition to these phenotypes, RXRα has been implicated in the embryonic morphogenesis of skeleton and cartilage (8). In a skin-specific RXRα mutant, progressive alopecia and cyst formation occurs (9;10) as in pinkie mice. Skin-specific RXRα mutant epidermis is also hyperplastic and hyperkeratinized (9;10). Several other tissue-specific RXRα mutants have been generated; more information on their phenotypes may be found at MGI.

 

An adequate supply of vitamin A is important for immune function, especially during infancy and early childhood (11). Vitamin A deficiency leads to impaired T-lymphocyte-mediated antibody responses (12), and also generates a bias towards T helper type 1 (Th1) cells (13). This bias may be attributed to increased interleukin-12 (IL-12) production by antigen-presenting cells (APCs) (14) and increased interferon-γ (IFN-γ) production by T lymphocytes (15). Conversely, RA treatment (using 9-cis RA) of T cells in vitro suppresses Th1, but enhances Th2 development (16). Recently, RXRα has been disrupted specifically in thymocytes and T lymphocytes using Cre-lox technology (17). In contrast to data from pinkie mice, naïve CD4+ T cells in vitro displayed no Th1 differentiation bias in thymocyte- and T lymphocyte-deficient RXRα (RXRα^ko/ko) mice as measured by intracellular staining for IL-4 and IFN-γ, and by antigen-specific IgG1 production in response to immunization with ovalbumin. However, RXRα^ko/ko memory CD4+ T cells produced more IFN-γ and IL-12 compared to wild type cells (17).

 

In addition to RARs, RXRα can heterodimerize with the VDR and contribute to signaling from this complex. 1,25-Dihydroxyvitamin D3 (vitD3) affects Th cell polarization by inhibiting secretion of IL-12 and IFN-γ, thus inhibiting Th1 development (18;19). VitD3 also enhances IL-4 and IL-10 production, leading to skewing towards Th2 development (19). A recent study reports that VDR-null mice exhibit progressive alopecia caused by the disruption of hair follicle structure (20).

Putative Mechanism

RXRα null mutants die as embryos, highlighting the importance of signaling from complexes that include this molecule. Although mutant RXRα in pinkie mice retains only 10% of its signaling activity, pinkie mice survive to adulthood, possibly due to the 2-fold upregulation of mRNA expression of mutant RXRα, and potential redundancy with RXRβ and RXRγ. Expression of the Rxrα locus is downregulated with age in hepatic cells (21), and may explain the progressive phenotype of pinkie mice. As these mice age, the combined reduction in RXRα activity due to downregulation of the locus and the loss of signaling function due to the mutation, may lead to a gradually worsening phenotype.

 

Figure 4. Hair follicle and growth cycle.  (A) The hair follicle consists of eight epithelial layers including the outer root sheath, companion layer, inner root sheath (consisting of Henle’s, Huxley’s and cuticle layers) and the hair shaft (consisting of the cuticle, cortex and medulla). All layers, with the exception of the outer root sheath, are derived from proliferative cells of the hair matrix, located around the dermal papilla at the base of the hair bulb.  (B) After hair follicles are established, hair is periodically shed and replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into three periods: the anagen phase (follicle growth), the catagen phase (regression), and the telogen phase (rest). Several signaling pathways are implicated in hair follicle regeneration. Mutations that affect the indicated stages of the cycle are noted in red text. Genes affected by these mutations are noted in black, italic text. Click on image to reveal related mutations. Click on mutations to view additional information.

Like skin-specific RXRα-deficient and VDR-null mice, pinkie mice develop alopecia. Hair follicle structure, and thus the hair cycle, is disrupted as a result of either skin-specific RXRα- or VDR-deletion (Figure 4) (10;20). Skin histology analysis revealed dilated hair follicles in pinkie mice. The dilated follicles or follicular ectasia were situated primarily within the deep dermis or superficial subcutis. The lumens of most ectatic structures were void of material but a few did contain some debris or fragments of keratin. Cysts form under the skin of pinkie mice, similar to skin-specific RXRα-deficient mice. Thus, defective RXRα/VDR signaling may account for the hair and skin phenotypes observed in pinkie mice. The signaling pathways downstream of RXRα which regulate hair growth and maintenance are unknown (please see the record for prune for more discussion).

 

pinkie mice display Th1-skewed Th cell function, consistent with data from thymocyte- and T lymphocyte-deficient RXRα mice and from studies of vitD3- or RA-treated T cells in culture. In these studies, increased vitD3- or RA-stimulated signaling favored Th2 development. In contrast, the RXRα mutation in pinkie mice would impair signaling from both the VDR and RAR complexes, leading to increased IL-12 production and promoting Th1 development.

 

Several transcription factors are important for differentiation into Th1 versus Th2 cell subsets. The transcription factors GATA-3 and c-Maf promote Th2 differentiation. Transgenic expression of GATA-3 (22) or overexpression of c-maf (23) in mice inhibited Th1 development while enhancing Th2 development. Lack of GATA-3, on the other hand, prevents the development of Th2 cells (24). Consistent with these data, cultured T cells from pinkie mice expressed slightly lower levels of GATA-3 mRNA.

 

The transcription factor T-bet has been implicated in directing the Th1 lineage. Expression of T-bet in Th2 cells redirects them to Th1 class (25), and T-bet-deficient mice have Th2-skewed CD4⁺ cell populations (26). Promotion of Th-1 development through T-bet depends on downregulation of GATA-3 (26). pinkie T cells express elevated levels of T-bet mRNA, which would contribute to lowering GATA-3 levels. However, culture conditions favoring exclusive Th2 differentiation still lead to Th2 in pinkie mice, indicating that pinkie T cells are Th2 competent. Apparently, the remaining GATA-3 in pinkie T cells is insufficient to promote significant Th2 differentiation. C-Maf levels in pinkie mice have not been measured.

 

Although pinkie eye development appears normal, the appearance of corneal opacity and dry eyes may be related to impaired RA signaling that causes embryonic ocular malformations.

 

Dorsal kyphosis in pinkie mice may be due to impaired RA and vitD3 signaling, as both vitamin A and vitamin D are important for bone development. Vitamin D deficiency causes rickets in humans (27), and RA can stimulate osteoclast formation (28). RXRα may signal with both RAR and VDR to maintain bone structure and prevent kyphosis in pinkie mice.

Primers

Primers cannot be located by automatic search.

Genotyping

Pinkie genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

Primers

Pink(F): 5’- GCTTCTTCTGATGACCACTGCCTTG -3’

Pink(R): 5’-ACACGGCTGCAGAGGTCACATAGAC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:30

4) 68°C             1:00

5) repeat steps (2-4) 35X

6) 68°C             5:00

7) 4°C               ∞

 

The following sequence of 512 nucleotides (from Genbank genomic region NC_000068 for linear DNA sequence of Rxra) is amplified:

 

74882  gcttcttct gatgaccact gccttggtac tagtcccgct ccaataagcc agggcttcct

74941 ccagcctgtt actatggtgg atctcttctc agagtccttt cactgtgcca ggcctccgat

75001 ggtttgggat gcagatcctg ggaccccact ccatgggtgt tttgtgtggg gtgaggtggc

75061 tctgtcggct atcaggtgtg aggtttgatc aatgtccttt ctccgttcta gccaaatgac

75121 cctgttacca acatctgtca agcagcagac aagcagctct tcactcttgt ggagtgggcc

75181 aagaggatcc cacacttttc tgagctgccc ctagacgacc aggtcatcct gctacgggca

75241 ggtgagtagc ctgggcaagt ggctgctagt ggatcagtgg gctcctgccc actcctgcat

75301 gcggtatagc gctaccttcc ccttccagct tagaaagtca gtaaagggtc tcctcggctg

75361 cccgccaggt ctatgtgacc tctgcagccg tgt

 

Primer binding sites are underlined; the mutated T is highlighted in red.

References

   1.  Du, X., Tabeta, K., Mann, N., Crozat, K., Mudd, S., and Beutler, B. (2005) An essential role for Rxralpha in the development of Th2 responses, Eur. J. Immunol. 35, 3414-3423.
   2.  Mark, M., Ghyselinck, N. B., and Chambon, P. (2006) Function of retinoid nuclear receptors: lessons from genetic and pharmacological dissections of the retinoic acid signaling pathway during mouse embryogenesis, Annu. Rev. Pharmacol. Toxicol. 46, 451-480.
   3.  Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H., and Moras, D. (1995) Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-alpha, Nature 375, 377-382.
   4.  Mangelsdorf, D. J., Borgmeyer, U., Heyman, R. A., Zhou, J. Y., Ong, E. S., Oro, A. E., Kakizuka, A., and Evans, R. M. (1992) Characterization of three RXR genes that mediate the action of 9-cis retinoic acid, Genes Dev. 6, 329-344.
   5.  Chambon, P. (1996) A decade of molecular biology of retinoic acid receptors, FASEB J. 10, 940-954.
   6.  Kastner, P., Grondona, J. M., Mark, M., Gansmuller, A., Lemeur, M., Decimo, D., Vonesch, J. L., Dolle, P., and Chambon, P. (1994) Genetic analysis of RXR alpha developmental function: convergence of RXR and RAR signaling pathways in heart and eye morphogenesis, Cell 78, 987-1003.
   7.  Sucov, H. M., Dyson, E., Gumeringer, C. L., Price, J., Chien, K. R., and Evans, R. M. (1994) RXR alpha mutant mice establish a genetic basis for vitamin A signaling in heart morphogenesis, Genes Dev. 8, 1007-1018.
   8.  Mascrez, B., Mark, M., Krezel, W., Dupe, V., Lemeur, M., Ghyselinck, N. B., and Chambon, P. (2001) Differential contributions of AF-1 and AF-2 activities to the developmental functions of RXR alpha, Development 128, 2049-2062.
   9.  Li, M., Indra, A. K., Warot, X., Brocard, J., Messaddeq, N., Kato, S., Metzger, D., and Chambon, P. (2000) Skin abnormalities generated by temporally controlled RXRalpha mutations in mouse epidermis, Nature 407, 633-636.
 10.  Li, M., Chiba, H., Warot, X., Messaddeq, N., Gerard, C., Chambon, P., and Metzger, D. (2001) RXR-alpha ablation in skin keratinocytes results in alopecia and epidermal alterations, Development 128, 675-688.
 11.  Stephensen, C. B. (2001) Vitamin A, infection, and immune function, Annu. Rev. Nutr. 21, 167-192.
 12.  Wiedermann, U., Hanson, L. A., Kahu, H., and Dahlgren, U. I. (1993) Aberrant T-cell function in vitro and impaired T-cell dependent antibody response in vivo in vitamin A-deficient rats, Immunology 80, 581-586.
 13.  Cantorna, M. T., Nashold, F. E., and Hayes, C. E. (1994) In vitamin A deficiency multiple mechanisms establish a regulatory T helper cell imbalance with excess Th1 and insufficient Th2 function, J. Immunol. 152, 1515-1522.
 14.  Cantorna, M. T., Nashold, F. E., and Hayes, C. E. (1995) Vitamin A deficiency results in a priming environment conducive for Th1 cell development, Eur. J. Immunol. 25, 1673-1679.
 15.  Carman, J. A. and Hayes, C. E. (1991) Abnormal regulation of IFN-gamma secretion in vitamin A deficiency, J. Immunol. 147, 1247-1252.
 16.  Iwata, M., Eshima, Y., and Kagechika, H. (2003) Retinoic acids exert direct effects on T cells to suppress Th1 development and enhance Th2 development via retinoic acid receptors, Int. Immunol. 15, 1017-1025.
 17.  Stephensen, C. B., Borowsky, A. D., and Lloyd, K. C. (2007) Disruption of Rxra gene in thymocytes and T lymphocytes modestly alters lymphocyte frequencies, proliferation, survival and T helper type 1/type 2 balance, Immunology.
 18.  Lemire, J. M., Archer, D. C., Beck, L., and Spiegelberg, H. L. (1995) Immunosuppressive actions of 1,25-dihydroxyvitamin D3: preferential inhibition of Th1 functions, J. Nutr. 125, 1704S-1708S.
 19.  Boonstra, A., Barrat, F. J., Crain, C., Heath, V. L., Savelkoul, H. F., and O'Garra, A. (2001) 1alpha,25-Dihydroxyvitamin d3 has a direct effect on naive CD4(+) T cells to enhance the development of Th2 cells, J. Immunol. 167, 4974-4980.
 20.  Bikle, D. D., Elalieh, H., Chang, S., Xie, Z., and Sundberg, J. P. (2006) Development and progression of alopecia in the vitamin D receptor null mouse, J. Cell Physiol 207, 340-353.
 21.  Chao, C., Youssef, J., Rezaiekhaleigh, M., Birnbaum, L. S., and Badr, M. (2002) Senescence-associated decline in hepatic peroxisomal enzyme activities corresponds with diminished levels of retinoid X receptor alpha, but not peroxisome proliferator-activated receptor alpha, Mech. Ageing Dev. 123, 1469-1476.
 22.  Nawijn, M. C., Dingjan, G. M., Ferreira, R., Lambrecht, B. N., Karis, A., Grosveld, F., Savelkoul, H., and Hendriks, R. W. (2001) Enforced expression of GATA-3 in transgenic mice inhibits Th1 differentiation and induces the formation of a T1/ST2-expressing Th2-committed T cell compartment in vivo, J. Immunol. 167, 724-732.
 23.  Ho, I. C., Lo, D., and Glimcher, L. H. (1998) c-maf promotes T helper cell type 2 (Th2) and attenuates Th1 differentiation by both interleukin 4-dependent and -independent mechanisms, J. Exp. Med. 188, 1859-1866.
 24.  Pai, S. Y., Truitt, M. L., and Ho, I. C. (2004) GATA-3 deficiency abrogates the development and maintenance of T helper type 2 cells, Proc. Natl. Acad. Sci. U. S. A 101, 1993-1998.
 25.  Szabo, S. J., Kim, S. T., Costa, G. L., Zhang, X., Fathman, C. G., and Glimcher, L. H. (2000) A novel transcription factor, T-bet, directs Th1 lineage commitment, Cell 100, 655-669.
 26.  Usui, T., Preiss, J. C., Kanno, Y., Yao, Z. J., Bream, J. H., O'Shea, J. J., and Strober, W. (2006) T-bet regulates Th1 responses through essential effects on GATA-3 function rather than on IFNG gene acetylation and transcription, J. Exp. Med. 203, 755-766.
 27.  Bouillon, R., Verstuyf, A., Mathieu, C., Van, C. S., Masuyama, R., Dehaes, P., and Carmeliet, G. (2006) Vitamin D resistance, Best. Pract. Res. Clin. Endocrinol. Metab 20, 627-645.
 28.  Scheven, B. A. and Hamilton, N. J. (1990) Retinoic acid and 1,25-dihydroxyvitamin D3 stimulate osteoclast formation by different mechanisms, Bone 11, 53-59.