Phenotypic Mutation 'souris' (pdf version)
Allelesouris
Mutation Type critical splice donor site (2 bp from exon)
Chromosome13
Coordinate13,683,224 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Lyst
Gene Name lysosomal trafficking regulator
Synonym(s) D13Sfk13
Chromosomal Location 13,590,409-13,777,440 bp (+)
MGI Phenotype Strain: 1855968
Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells.
Accession Number

NCBI RefSeq: NM_010748; MGI: 107448

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000106188 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Beach 3118 3408 1.25e-193 SMART
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Phenotypic Category decrease in NK cell response, hematopoietic system, immune system, MCMV susceptibility, pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(45) : Gene trapped(30) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 unclassified probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 unclassified probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 unclassified probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charlotte_gray UTSW 13 13602026 nonsense
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice donor site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
JAX1:Lyst UTSW 13 13635383 missense probably damaging 1.00
JAX1:Lyst UTSW 13 13677952 missense probably benign 0.00
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1709:Lyst UTSW 13 13707616 splice acceptor site
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 unclassified probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 unclassified probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 unclassified probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13683043 splice acceptor site probably benign
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
X0060:Lyst UTSW 13 13650317 splice acceptor site probably benign
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
MMRRC Submission 010470-UCD
Last Updated 05/24/2017 10:39 AM by Katherine Timer
Record Created unknown
Record Posted 10/10/2007
Phenotypic Description
The souris phenotype was identified in two ENU-induced G3 littermates. Souris mice have a uniform dark gray coat color. The ears, feet and tail have a light pink to white color. The souris mutation confers mouse cytomegalovirus (MCMV) susceptibility, with homozygotes exhibiting a high splenic viral titer 5 days post-infection (similar to MCMV-infected Balb/c mice) (MCMV Susceptibility and Resistance Screen). Souris mice are susceptible to infection with Listeria monocytogenes. NK cells from souris mice fail to degranulate after antibody stimulation of NKp46 or Ly49H receptors, or after exposure to YAC-1 cells or PMA/ionomycin. However, intracellular production of interferon (IFN)-γ is normal after PMA/ionomycin stimulation.
 
Complementation testing demonstrated that the souris mutation is allelic with the beige locus, in which a Lyst mutation was identified (1;2).
Nature of Mutation
The souris mutation was mapped to Chromosome 13, and corresponds to a T to A transversion in the donor splice site of intron 27 (GTAAG -> GAAAG) of the Lyst gene (position 92815 in the Genbank genomic region NC_000079 for linear genomic DNA sequence of Lyst).  As Lyst cDNA from souris mice has not been sequenced, it is unknown how the mutation affects processing of the Lyst transcript.  The mutation likely results in skipping of the 167-nucleotide exon 27 (out of 53 total exons), destroying the reading frame (aberrant amino acids after position 2474), and creating a premature stop codon that would truncate the protein after amino acid 2482:
      <-- exon 26  <--exon 27 intron 27-->  exon 28-->
91104 TTAGAAAAGAA……AGGACACAAA GTAAGAATG……………ATATGGCTTTGGCCCTGCAGCTTAG 93574
2472  -L--E--K--N……-R--T--Q--               --Y--G--F--F--P--A--A--*  2482
       correct      deleted                         aberrant
The donor splice site of intron 27, which is destroyed by the souris mutation, is shown in blue; the mutated nucleotide is shown in red.
Protein Prediction
Figure 1. Domain structure of the Lyst protein. The Lyst protein is a 3788-amino acid protein whose biochemical functions remain unknown. The N-terminal portion of the protein contains approximately twenty repeats with homology to ARM  and HEAT repeat motifs and a perilipin domain (PD). The C-terminal portion of Lyst contains a BEACH  domain and seven WD40 motifs. The souris mutation occurs in intron 27 and results in eight aberrant amino acids after position 2474, followed by premature truncation of the protein after amino acid 2482. This image is interactive. Click on the image to view other mutations found in Lyst (red). Click on the mutations for more specific information. There are two additional alleles in the Lyst gene: sooty and grey wolf. The locations of their mutations is unknown.
The Lyst gene encodes the protein Lyst (also CHS/Beige), a 3788-amino acid protein whose biochemical functions remain unknown (Figure 1). A large N-terminal portion of the protein (amino acids 1-3132) contains approximately twenty repeats with homology to ARM (Armadillo) and HEAT (huntingtin, elongation factor 3, A subunit of protein phosphatase A, target of rapamycin) repeat motifs (3;4). ARM and HEAT motifs are α-helical domains of about 50 amino acids that pack together to form elongated “solenoids” (5); evidence suggests they mediate protein associations at the membrane (6), and vesicle transport (7), respectively. A perilipin domain (amino acids 1079-1313) may interact with lipids, as has been suggested for several other proteins (8). A 674-amino acid construct containing the perilipin domain can function as a dominant negative peptide that causes enlarged lysosomes when overexpressed in Cos-7 or HeLa cells (9). The C-terminus of Lyst contains two distinct domains, a BEACH (beige and chediak) domain (amino acids 3132-3472) and seven WD40 motifs (3). The BEACH domain is a 345-amino acid region of unknown function (3), and WD40 motifs are protein interaction motifs that typically form β sheets arranged in a 7-bladed β propeller fold (10). Database searches have identified one or more proteins in each of S. cerevisiae, C. elegans, D. discoideum, D. melanogaster, mice and humans that contain both BEACH and WD40 domains (3;4). So far, these proteins appear to have diverse functions [reviewed in (4)]. Notably, a C-terminal fragment of Lyst containing the BEACH and WD40 domains can act dominant negatively to cause enlarged lysosomes when expressed in Cos-7 or HeLa cells (9).
 
In addition to these protein domains, Lyst also contains potential phosphorylation sites for protein kinase C (PKC), casein kinase II (CKII), c-AMP-dependent protein kinase, and a tyrosine kinase (1).
 
The souris mutation results in eight aberrant amino acids after position 2474, followed by premature truncation of the protein.  This would delete four of the ARM/HEAT motifs, the BEACH domain and the WD40 motifs.  Expression of the mutated Lyst protein has not been tested.
Expression/Localization
Lyst transcripts are expressed ubiquitously in both mouse and human tissues (1;2). Several alternative transcripts are detected in various tissues, but their functional differences are unknown (1;11). The Lyst protein is localized in the cytoplasm (9;12).
Background
Figure 2. Biogenesis of lysosomes and lysosome-relateded organelles (LORs). Lysosomes are  cytoplasmic organelles responsible for degradation within a cell. LROs share some features with lysosomes but have distinct morphologies and functions.
In humans, mutations in the Lyst gene cause Chediak-Higashi Syndrome (CHS, OMIM #214500), a rare autosomal recessive disorder characterized by oculocutaneous albinism, severe immune deficiency, bleeding tendency, recurrent pyogenic infection, progressive neurologic defects and a lymphoproliferative syndrome [(1;2), reviewed in (4)]. These defects are caused by the aberrant formation of giant granules within a variety of cell types, and disrupted intracellular protein trafficking (4;13;14). The enlarged granules consist of organelles such as lysosomes, melanosomes, cytolytic granules and platelet dense bodies, and it is thought that the increased size of these organelles inhibits their migration and fusion at the cell surface and/or organelle-organelle fusion (Figure 2). For example, CHS melanocytes produce normal amounts of melanin, the pigment for skin, hair and eyes, but melanosomes are abnormally large and fail to release their contents for absorption by keratinocytes (15). Secretion of abnormally large platelet dense bodies is delayed in CHS platelets, resulting in defective platelet coagulation and the bleeding tendency of CHS patients (16;17).
 
Defective lysosome-related functions in immune cells lead to immune deficiency, recurrent bacterial infections and lymphoproliferative disorder in CHS patients. CHS macrophages and polymorphonuclear leukocytes have normal phagocytic ability, but delayed fusion of phagosomes with lysosomes, allowing bacterial replication and escape and leading to persistent infections (4). Cytolytic T cells (CTLs) from CHS patients also fail to kill target cells recognized by the T cell receptor (TCR) due to an inability to secrete granules containing lytic proteins (18). Although these granules are abnormally large in CHS CTLs, they contain normal levels of properly processed lytic proteins (18;19). CHS patients also have impaired NK cell function, presumably due to defective degranulation of the single large granule, rather than the normal multiple small granules, present in these cells (20;21). Patients may also display an ‘accelerated phase’ of the disease, in which activated T cells infiltrate the major organs of the body; this phase may be associated with viral infection (22).
 
Human patients with CHS usually die during childhood from the immunologic complications of the disease. Bone marrow transplantation is an effective treatment to extend the lifespan of patients (23;24), although it does not prevent the extrahematopoietic symptoms of CHS. Humans with CHS that receive bone marrow transplant and live into adulthood develop neurologic defects including ataxia, sensory deficits and neurodegeneration (25). These are thought to result from accumulation of cytoplasmic inclusions in neurons that may prevent normal synaptic transmission (26).
 
In mice, mutations in Lyst cause the beige phenotype (1;2). As in humans, beige mice exhibit hypopigmentation, bleeding tendency, and defective immune cell function resulting from the formation of giant granules in melanosomes, lymphocytes, neutrophils, and other cell types (14;27;28). Beige mice have defective NK cell (29) and CTL function (30), and increased susceptibility to infections (31;32). However, beige mice do not develop lymphoproliferative disorder, even after challenge with infection (31).
Putative Mechanism
There is no clear understanding of the molecular mechanisms of Lyst protein function, or how its loss leads to the formation of enlarged lysosomes and lysosome-related organelles. Overexpression of Lyst in cultured mouse fibroblasts results in reduced lysosome size, suggesting that Lyst is important for vesicle fission (12). On the other hand, a yeast-two hybrid screen of cDNA libraries from human heart, keratinocyte, fetal brain, fetal liver and fetal kidney identified Lyst interactions with several regulators of the SNARE [SNAP (soluble NSF attachment protein) receptor] complex, which mediates vesicle fusion with the cell membrane or with target compartments such as lysosomes (33). Although the interactions were tested in vitro and have yet to be confirmed genetically, they raise the possibility that Lyst regulates SNARE-mediated membrane fusion. In support of this hypothesis, lysosomal exocytosis and membrane resealing are impaired after membrane wounding in CHS or beige fibroblasts (34). Lysosomal exocytosis contributes to the repair of plasma membrane lesions in a Ca2+-dependent manner. Furthermore, survival of membrane-wounded CHS and beige fibroblasts is reduced compared to wild type, and correlates with levels of lysosomal exocytosis (34). Thus, these data suggest that Lyst promotes both the processes of vesicle budding and vesicle fusion.
 
Unfortunately, studies of related proteins from other species containing both BEACH and WD40 domains do not shed much light on the function of Lyst. The functions of such proteins appear to be quite diverse (4). Studies of the LvsB protein of D. Discoideum, the closest BEACH- and WD40-containing homolog of Lyst in this species, indicate that LvsB in fact negatively regulates lysosome fusion (35;36). LvsB-null mutants contain enlarged vesicles that appear to be acidic lysosomes, and display increased fusion rates (35). A common mechanism or function shared by all BEACH- and WD40-containing proteins remains to be discovered.
 
Reports suggest that Lyst may regulate protein kinase C (PKC) activity. Membrane-bound PKC activity is reportedly abnormally downregulated in beige fibroblasts, macrophages and polymorphonuclear leukocytes after phorbol ester treatment (37). This aberrant PKC downregulation, and the formation of giant granules, can be inhibited by treatment with the thiol proteinase inhibitor E-64-d, a calpain inhibitor (38). The authors suggest that inhibition of calpain-mediated PKC proteolysis prevents giant granule formation (38). The mechanism of PKC regulation of lysosomes is unknown.
 
The souris mutation may result in expression of a significantly truncated protein missing four of the ARM/HEAT motifs, as well as the BEACH and WD40 domains.  Although the exact function of these domains remain to be discovered, it is likely that the souris mutation results in a protein with severely affected function.
Primers Primers cannot be located by automatic search.
Genotyping
Souris genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  
 
Primers for PCR amplification
Souris(F): 5’- TCACCCTTCATGTAGACCAGGAACC -3’
Souris(R): 5’- TGCAGGGCCAAAGCCATATCTAAAC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Souris_seq(F): 5’- CAGAAGTCAATGTGCCTTACTTGC -3’
Souris_seq(R): 5’- GATGACCTTGAAATTCTGACCATCC -3’
 
The following sequence of 1228 nucleotides (from Genbank genomic region NC_000079 for linear genomic sequence of Lyst) is amplified:
 
92341 tcacccttca tgtagaccag gaacctgtgt gagtgttctc tgtgtatctt gtgttaatct
92401 ctagctgttg tttatgttgc tctcttaacc tgtatctttc tctacaagac tgtattttca
92461 acagaagtca atgtgcctta cttgcattcc tagtgggcag ggtatattgc ttgctgtata
92521 gagtaaacat gaacagttct taaatcattg catgctggta gcgtagagtt taaccagttc
92581 tttgtctttt aatttttcgg ctgttttgct tatagtatct tctgttttgt tttggactca
92641 ctttagcatt cctgtgaacg aatacaaatt gctcgcatgt gatatacagc agcttttcat
92701 agcagttaca attcatgctt gcagttcctc aggcacacag tattttagag tgattgaaga
92761 ccttattgta cttcttggat atcttcataa tagcaaaaac aagaggacac aaagtaagaa
92821 tggattttaa tggaattttt ctcataactt ttactgaaga tttaaagtta attatgtgtt
92881 ggtattaatt ggtatttaaa gcaaccttta aattgttgaa aatagagtga ttgatggttt
92941 gatgtaatta gtagttggca atacatcact ggcagaaact agtaattttt tttaccaagt
93001 agaatacaaa ggcatatgtt ggaagaataa tgggaatgct agcgtgactc atgagtgaaa
93061 gcgtgtaggg tattggagct tttgctttat acaaagttat tggtttttga aacagtcatt
93121 taaagtgaaa tcagtttagg atttatcatt ttttctattc aaatttttat agttgtagct
93181 agatatggtg atacatattc aagagatgga ggcaggatgg tcagaatttc aaggtcatct
93241 tcagctacat agcaggctaa cctgggctac aggaaacatg tctcaaaaat atcaaaaaat
93301 ttgtagtgac catatgggaa tttattttaa cattattttt aaatgtagct tagaaacact
93361 aacatcaaga acccatgttg atgaaacaat tttaacttgt gtctaaggcc ttttcattta
93421 gatattgaat attatagctt gaatattagg ttatatgcct tagatgttag ataatatatt
93481 aaataagttt agttaaaaga gttaaacaat tatgatagct tgaaaacatt ctagtctctt
93541 tgggtttaga tatggctttg gccctgca
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red.
 
References
 27.  Kelly, E. M. (1957) Beige, bg, Mouse News Lett 16, 36.
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine, Katherine Timer
AuthorsSophie Rutschmann, Celine Eidenschenk, Bruce Beutler
Edit History
01/07/2011 9:44 AM (current)
07/22/2010 10:13 AM
01/18/2010 12:00 AM