Phenotypic Mutation 'zigzag'

• Allele: zigzag
• Mutation Type: missense
• Chromosome: 5
• Coordinate: 140,598,290 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Lfng
• Gene Name: LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
• Synonym(s): lunatic fringe
• Chromosomal Location: 140,593,096-140,601,300 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and manic fringe genes. They all encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. This gene product is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit a short tail and abnormal rib, somite, and lung development. Mice homozygous mice exhibit reduced female fertility, abnormal hair cells, and abnormal axial skeleton morphology. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Alanine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: O09010
• SMART Domains: Protein: ENSMUSP00000031555; Gene: ENSMUSG00000029570; AA Change: V204A

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	37	60	N/A	INTRINSIC
Pfam:Fringe	107	357	9.6e-124	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000031555)
• Meta Mutation Damage Score: 0.9413
• Is this an essential gene?: Probably essential (E-score: 0.905)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm
• MMRRC Submission: 030349-UCD
• Last Updated: 2017-05-02 11:18 AM by Katherine Timer
• Record Created: unknown
• Record Posted: 2007-10-11
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Celine Eidenschenk, Bruce Beutler

Accession Number

NCBI RefSeq: NM_008494; MGI: 1095413

Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1) Chemically induced(1)

Phenotypic Description

The zigzag phenotype was identified visually among ENU-induced G3 mutant mice. Zigzag mutants have a shortened, squat body and a short, bent tail. The axial skeleton of zigzag mice is perturbed, and vertebral fusion is apparent.

 

One homozygote pup was born from a cross of homozygote parents after several months. Thus, homozygotes appear to have reduced fertility, although they are capable of breeding. Heterozygote zigzag mice are viable and fertile as normal.

 

Zigzag mutants have normal numbers of peripheral CD4⁺ and CD8⁺ T cells, and exhibit normal resistance to mouse cytomegalovirus (MCMV) (MCMV Susceptibility and Resistance Screen).

Nature of Mutation

The zigzag mutation was mapped to Chromosome 5, and corresponds to a T to C transition at position 686 of the Lfng transcript, in exon 4 of 8 total exons.

 

670 GATGATGACAACTACGTCAACCTCCGGGCGCTG

199 -D--D--D--N--Y--V--N--L--R--A--L-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of valine to alanine at residue 204 of the Lfng protein.

Protein Prediction

Lfng encodes the 378-amino acid protein Lunatic fringe (Lfng), one of three mammalian fringe proteins identified based on their gene sequence homology to Drosophila fringe (D-fng) (1;2). Fringe proteins have been identified in all metazoans tested to date, including Xenopus (3), zebrafish (4;5) and humans (1). The approximately 270 amino acids at the C termini of all fringe proteins are highly conserved. Within this region are six cysteine residues that form intramolecular disulfide bonds; they are found in identical positions in all vertebrate fringe proteins, and in Drosophila fringe (D-fng) (1;2;6). Lfng has several glycosylation sites by which the protein may be posttranslationally modified (1). Lfng, like all fringe proteins, also shows sequence and structural similarity to glycosyltransferases (amino acids 111-297) (7). Indeed, Lfng has glycosyltransferase activity, and exerts its biological function through this activity (8;9). Lfng specifically elongates O-linked fucose residues through the addition of UDP-N-acetylglucosamine (GlcNAc) (8;9).

 

Lfng contains a predicted N-terminal signal sequence (amino acids 1-26), and a pro-peptide (amino acids 27-79) followed by a basic proteolytic cleavage site (1;2). Thus, Lfng was originally predicted to function as a secreted protein factor (1;2). When expressed in COS cells, an alkaline phosphatase-tagged Lfng protein is secreted into the culture media as two species whose sizes are consistent with the pro- and mature protein forms (1). However, genetic analysis in Drosophila supports a cell autonomous role for D-fng in wing development (10-12), and more recent data demonstrate that D-fng is not secreted, but functions in a cell autonomous manner as a Golgi apparatus resident protein (13;14). Lfng is also a Golgi-localized protein, and exerts a cell autonomous function (15).

 

The zigzag mutation results in the substitution of valine 204 with alanine in the Lfng protein. A valine is present at this position in all mouse, human and Drosophila fringe proteins, suggesting it is important for the function of all fringe proteins. The mutation resides within the most highly conserved region among fringe proteins, also the region containing the glycosyltransferase domain (7;13;14). Valine 204 is positioned three residues C-terminal to the critical Asp-x-Asp motif required for glycosyltransferase activity and which coordinates a divalent metal ion during the binding of the donor nucleotide sugar (6;16). Mutating one or more of these aspartic acid residues abolishes fringe biological activity (8;13;14). Mutation of valine 204 likely disrupts the glycosyltransferase activity of the protein.

 

Expression/Localization

The expression of Lfng is highly regulated during embryonic development. Lfng expression is dynamically regulated, and is found at many critical segmental boundaries that set up the pattern for proper tissue and organ development in the embryo. Development of the vertebrae proceeds from the anterior to the posterior, with each vertebra arising from a block of tissue called a somite, which in turn arises from embryonic tissue termed presomitic mesoderm. Lfng is highly expressed in the presomitic mesoderm in two stripes at the posterior boundaries of nascent somites (1;2). Once each somite has formed, Lfng transcript levels rapidly decline, increasing again in more posterior developing somites (1;2). Lfng is also expressed in undifferentiated neuroblastic cells of the neural tube ventricular zone. As these cells differentiate into neurons and leave the ventricular zone, Lfng expression is downregulated (1;2). This pattern of Lfng expression, occurring as it does in stem cells and turned off in committed progeny, is also apparent for myoblasts, neurons of the retina, epidermal cells, fetal heart, hematopoietic cells in fetal liver, splenic lymphocytes, and thymocytes (2).

 

Lfng continues to be expressed during adulthood (1;2;17), with particularly high levels in brain, spleen and small intestine (17).

 

As discussed above (Protein prediction), Lfng is localized to the Golgi apparatus (18).

Background

The Notch protein family is a group of transmembrane receptors controlling cell-cell signaling during cell growth, proliferation, survival, fate determination, differentiation and morphogenesis (19;20). Notch plays a particularly prominent role during embryonic patterning, mediating lateral inhibition, induction, and boundary formation. First discovered in Drosophila, Notch proteins are now known to signal in organisms from yeast to humans. Not surprisingly, Notch activity must be tightly regulated, and multiple mechanisms, including fringe-mediated glycosylation, exist for such regulation (20).

 

Notch receptors are heterodimers consisting of two non-covalently linked proteins, the Notch extracellular domain (NECD) and a transmembrane-spanning intracellular domain (NTM). The NECD and NTM arise from cleavage in the Golgi apparatus at site S1 of a single Notch precursor by a convertase of the furin family; the NECD and NTM remain associated in a Ca2⁺-dependent manner, and are presented at the membrane (21;22). Notch signaling is activated by the DSL family of ligands (named for Delta and Serrate from Drosophila, and lag-2 from C. elegans), consisting of several Delta-like (Dll) and Serrate-like (known as Jagged) proteins in mammals (23). Dll and Jagged proteins are transmembrane proteins which may activate Notch in cis or in trans. Upon ligand binding, the NTM is cleaved at the S2 site by proteases of the ADAM/TACE/Kuzbanian family, releasing the NECD and generating an activated membrane-bound form of Notch called Notch Extracellular Truncation (NEXT). NEXT is cleaved at two sites, S3 and S4, within the membrane by the γ-secretase complex Presenilin-Nicastrin-Aph1-Pen2. This releases the Notch intracellular domain (NICD), the active form of Notch, inside the cell and a small peptide, Nβ, extracellularly. NICD translocates to the nucleus, where it forms a complex with the transcription factors CSL [human CBF1 (EBV latency C promoter binding factor, also known by many other names), fly Suppressor of Hairless (Su(H)), worm Lag-1] and the Mastermind (Mam)/Lag-3 coactivator, to turn on target gene expression. [Entire pathway reviewed in (20); see references therein.]

 

The NECD contains multiple epidermal growth factor (EGF)-like repeats which may be glycosylated by several different enzymes (24). O-fucosylation is mediated by O-fucosyltransferase 1, and deletion of this protein in mice results in a phenotype similar to that of mice lacking Notch signaling (25). Further studies demonstrate that O-fucosylation promotes Notch interaction with ligand (26), an interaction facilitated at least in part by the fringe glycosyltransferases. Fringe proteins in both flies and mice physically interact with Notch, elongating O-linked fucose residues on specific EGF-like repeats by the addition of UDP-N-acetylglucosamine (GlcNAc) (8;9;12;14). This fringe-mediated glycosylation controls the affinity of Notch for its various ligands, thereby modulating downstream Notch signaling.

 

Recently, mutation of human LFNG was shown to cause spondylocostal dysostosis (SCD), a disorder of vertebral malsegmentation caused by disrupted somite development during embryogenesis (OMIM #277300). The mutation identified in a single family with autosomal recessive SCD was a missense mutation in a conserved phenylalanine residue close to the active site of the protein (27).

Putative Mechanism

Vertebrae develop from somites, which form as a series of buds from the anterior end of the presomitic mesoderm. At the same time, the presomitic mesoderm grows at its posterior end by the addition of epiblast cells. The production of somites has a characteristic timing in each species, and this timing is translated into a repeating pattern of somite boundaries through the establishment of the polarized organization of individual somites. The Notch signaling pathway plays a critical role in somite development from the presomitic mesoderm, governing (along with Wnt proteins) the temporal oscillation of gene expression which is converted into gradients of Fgf8 and Wnt3a, and in turn into a repeated array of regularly spaced somite boundaries (28;29). This temporal oscillation of gene expression controlling the rhythm of somite formation is termed the molecular oscillator, or the segmentation clock.

 

Lfng is the only mammalian fringe protein expressed in the presomitic mesoderm, where it has now been demonstrated to regulate boundary formation between somites, as well as the anterior-posterior patterning of individual somites (30;31). Lfng^-/- mice have irregularly shaped somites with disrupted polarity, as evidenced by the diffuse, even expression of uncx4.1, Mox1, pax9 and delta-1, genes normally polarized to the posterior half-somite (30;31). As a result, Lfng^-/- mice have skeletal abnormalities in which the vertebral structure is severely disorganized, with fused vertebrae and ribs, and incompletely formed vertebrae (30;31).

 

Notch signaling proteins, including Lfng, follow a cyclic expression pattern corresponding with somitogenesis in the presomitic mesoderm. The periodic pattern of Lfng expression is regulated at the transcriptional level by a 2.3 kb region of the Lfng promoter containing sequences mediating both repression and enhancement (32;33). Lfng is thus able to inhibit Notch signaling periodically in the presomitic mesoderm, and thereby control the expression of Notch-regulated genes (34;35). As in Lfng^-/- mice, mutations of Notch signaling components, including Notch1, Delta1 (Dl1), Dl3, and hes7, result in irregularly shaped somites with disrupted anterior-posterior organization (36-38).

 

Notch1 controls the lineage decision of thymic progenitors to form T cells rather than B cells (39;40), and also functions to regulate the progression of early T cells through the phases of the CD4^-CD8^- double negative (DN) stage (41). Lfng has recently been implicated in the Notch1-regulated lineage commitment of thymic T cells (42;43). Thymocytes ectopically expressing Lfng have reduced Notch activity and induce lymphoid progenitors to develop into B cells in the thymus (42). Interestingly, Lfng function in T cell commitment may be non-cell autonomous, as progenitors overexpressing Lfng transgenically can block T lymphopoiesis by wild type progenitors in competitive adoptive transfer experiments (42;43). Conversely, Lfng-null progenitors generate only very few thymocytes compared to wild type cells in this experiment (43). Lfng may regulate T cell commitment by controlling access of T cell progenitors to intrathymic niches that support Notch-dependent stages of T cell development (43). Under non-competitive conditions, Lfng-null progenitors generate normal numbers of all hematopoietic lineages, including DP thymocytes and peripheral T cells (43). In addition, the proportions of CD4⁺ and CD8⁺ T cells are normal, as observed in zigzag mice. The ability of Lfng to control progenitor competition for intrathymic niches has been suggested as a mechanism for homeostatic regulation of thymus size (43).

Primers

Primers cannot be located by automatic search.

Genotyping

Zigzag genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

 

Primers

zigzag (F): 5’- AGCTGGAAGGCTCAAGATCCTGTC -3’

zigzag (R): 5’-AAGTGTCCTCCACTGCAAGGGAAG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             2:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C              ∞

 

Primers for sequencing

zigzag_seq(F): 5’- CTTATGCAGAGGAGACCCTTTCAG -3’

zigzag_seq(R): 5’- TGGGAGACACTCACCACTTTG -3’

 

The following sequence of 1353 nucleotides (from Genbank genomic region NC_000071 for linear genomic sequence of Lfng) is amplified:

 

4475                                      agctgg aaggctcaag atcctgtctc

4501 ttcttccaga cgttcatctt cactgatggg gaggacgaag ctctggccaa gctcacaggt

4561 tggtcccagg cttgggggtg gggatgaggg tgggaggcgc tggtcccaag caacttcttc

4621 ccccgaggct gtgaggtcac tggctgccgc ctcggggcta agaggccagt tcactcggct

4681 tgtttgcttc atgccccgcc ccaccactcc ccgggccccg attcttatgc agaggagacc

4741 ctttcagtcc tctggggacc ctttgagtcc cgcttagcag caacaggtgg cgggtactgg

4801 gggaaaaaaa actggctgaa tgaatgggca gcggtggcta ccctggggag ggggctaggc

4861 tgggcagggc tggggctaag gttcgaagca atgagaaatg cctgccgctt gtgcggacca

4921 ggcctgctta cgggccctcc ccgtccacag gcaatgtggt gctcaccaac tgctcctcgg

4981 cccacagccg ccaggctctg tcctgcaaga tggctgtgga gtatgaccga ttcattgagt

5041 ctgggaagaa gtgagttcct acctttccct ctgtgcccca tccgtgcccc ttccctggca

5101 gcccggcagc cctcgacccc tgtctgcagc ccctgacagc atccctcccg ccttgtgttc

5161 aggtggttct gccacgtgga tgatgacaac tacgtcaacc tccgggcgct gctgcggctc

5221 ctggccagct atccccacac ccaagacgtg tacatcggca agcccagcct ggacaggccc

5281 atccaggcca cagaacggat cagcgagcac aaagtggtga gtgtctccca gggtagcaca

5341 caccctgagg tgttagggag gggctgagcc acctttgcaa ccaggagtct cctgacagcc

5401 cttgtttcac ttcacccaga gacctgtcca cttttggttt gccaccggag gagctggctt

5461 ctgcatcagc cgagggctgg ccctaaagat gggcccatgg gccaggtgag tgtcccctgc

5521 ctagttgcca ctacccctga cagcagactg ttcctggtgc tcgctcttgg tcctgggttc

5581 cctgcagcag cagcgtctgg cttgggctat tctctccctg ccttaggtag ctgtgttttc

5641 tgccactctc tctacctctg ataaagtctt cggcatggaa ggactctggc tcatggcggg

5701 gcggggcata gtggactccc tctttttggg gccagtttgg caaagtcttg tctactcatg

5761 gcccagctac tggcttcagc ctctacttac tcttccccgg gcccttccct tgcagtggag

5821 gacactt

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

 

References

   1.  Johnston, S. H., Rauskolb, C., Wilson, R., Prabhakaran, B., Irvine, K. D., and Vogt, T. F. (1997) A family of mammalian Fringe genes implicated in boundary determination and the Notch pathway, Development 124, 2245-2254.

   2.  Cohen, B., Bashirullah, A., Dagnino, L., Campbell, C., Fisher, W. W., Leow, C. C., Whiting, E., Ryan, D., Zinyk, D., Boulianne, G., Hui, C. C., Gallie, B., Phillips, R. A., Lipshitz, H. D., and Egan, S. E. (1997) Fringe boundaries coincide with Notch-dependent patterning centres in mammals and alter Notch-dependent development in Drosophila, Nat. Genet. 16, 283-288.

   3.  Wu, J. Y., Wen, L., Zhang, W. J., and Rao, Y. (1996) The secreted product of Xenopus gene lunatic Fringe, a vertebrate signaling molecule, Science 273, 355-358.

   4.  Prince, V. E., Holley, S. A., Bally-Cuif, L., Prabhakaran, B., Oates, A. C., Ho, R. K., and Vogt, T. F. (2001) Zebrafish lunatic fringe demarcates segmental boundaries, Mech. Dev. 105, 175-180.

   5.  Qiu, X., Xu, H., Haddon, C., Lewis, J., and Jiang, Y. J. (2004) Sequence and embryonic expression of three zebrafish fringe genes: lunatic fringe, radical fringe, and manic fringe, Dev. Dyn. 231, 621-630.

   6.  Jinek, M., Chen, Y. W., Clausen, H., Cohen, S. M., and Conti, E. (2006) Structural insights into the Notch-modifying glycosyltransferase Fringe, Nat. Struct. Mol. Biol. 13, 945-946.

   7.  Yuan, Y. P., Schultz, J., Mlodzik, M., and Bork, P. (1997) Secreted fringe-like signaling molecules may be glycosyltransferases, Cell 88, 9-11.

   8.  Moloney, D. J., Panin, V. M., Johnston, S. H., Chen, J., Shao, L., Wilson, R., Wang, Y., Stanley, P., Irvine, K. D., Haltiwanger, R. S., and Vogt, T. F. (2000) Fringe is a glycosyltransferase that modifies Notch, Nature 406, 369-375.

   9.  Shao, L., Moloney, D. J., and Haltiwanger, R. (2003) Fringe modifies O-fucose on mouse Notch1 at epidermal growth factor-like repeats within the ligand-binding site and the Abruptex region, J Biol. Chem. 278, 7775-7782.

 10.  Kim, J., Irvine, K. D., and Carroll, S. B. (1995) Cell recognition, signal induction, and symmetrical gene activation at the dorsal-ventral boundary of the developing Drosophila wing, Cell 82, 795-802.

 11.  Panin, V. M., Papayannopoulos, V., Wilson, R., and Irvine, K. D. (1997) Fringe modulates Notch-ligand interactions, Nature 387, 908-912.

 12.  Ju, B. G., Jeong, S., Bae, E., Hyun, S., Carroll, S. B., Yim, J., and Kim, J. (2000) Fringe forms a complex with Notch, Nature 405, 191-195.

 13.  Munro, S. and Freeman, M. (2000) The notch signalling regulator fringe acts in the Golgi apparatus and requires the glycosyltransferase signature motif DXD, Curr. Biol. 10, 813-820.

 14.  Bruckner, K., Perez, L., Clausen, H., and Cohen, S. (2000) Glycosyltransferase activity of Fringe modulates Notch-Delta interactions, Nature 406, 411-415.

 15.  Hicks, C., Johnston, S. H., diSibio, G., Collazo, A., Vogt, T. F., and Weinmaster, G. (2000) Fringe differentially modulates Jagged1 and Delta1 signalling through Notch1 and Notch2, Nat. Cell Biol. 2, 515-520.

 16.  Breton, C. and Imberty, A. (1999) Structure/function studies of glycosyltransferases, Curr. Opin. Struct. Biol. 9, 563-571.

 17.  Moran, J. L., Johnston, S. H., Rauskolb, C., Bhalerao, J., Bowcock, A. M., and Vogt, T. F. (1999) Genomic structure, mapping, and expression analysis of the mammalian Lunatic, Manic, and Radical fringe genes, Mamm. Genome 10, 535-541.

 18.  Gantz, I., Miwa, H., Konda, Y., Shimoto, Y., Tashiro, T., Watson, S. J., DelValle, J., and Yamada, T. (1993) Molecular Cloning, Expression, and Gene Localization of a Fourth
Melanocortin Receptor, J. Biol. Chem. 268, 15174-15179.

 19.  rtavanis-Tsakonas, S., Rand, M. D., and Lake, R. J. (1999) Notch signaling: cell fate control and signal integration in development, Science 284, 770-776.

 20.  Schweisguth, F. (2004) Regulation of notch signaling activity, Curr. Biol. 14, R129-R138.

 21.  Blaumueller, C. M., Qi, H., Zagouras, P., and rtavanis-Tsakonas, S. (1997) Intracellular cleavage of Notch leads to a heterodimeric receptor on the plasma membrane, Cell 90, 281-291.

 22.  Logeat, F., Bessia, C., Brou, C., LeBail, O., Jarriault, S., Seidah, N. G., and Israel, A. (1998) The Notch1 receptor is cleaved constitutively by a furin-like convertase, Proc. Natl. Acad. Sci. U. S. A 95, 8108-8112.

 23.  Fleming, R. J. (1998) Structural conservation of Notch receptors and ligands, Semin. Cell Dev. Biol. 9, 599-607.

 24.  Wharton, K. A., Johansen, K. M., Xu, T., and rtavanis-Tsakonas, S. (1985) Nucleotide sequence from the neurogenic locus notch implies a gene product that shares homology with proteins containing EGF-like repeats, Cell 43, 567-581.

 25.  Shi, S. and Stanley, P. (2003) Protein O-fucosyltransferase 1 is an essential component of Notch signaling pathways, Proc. Natl. Acad. Sci. U. S. A 100, 5234-5239.

 26.  Okajima, T., Xu, A., and Irvine, K. D. (2003) Modulation of notch-ligand binding by protein O-fucosyltransferase 1 and fringe, J Biol. Chem. 278, 42340-42345.

 27.  Sparrow, D. B., Chapman, G., Wouters, M. A., Whittock, N. V., Ellard, S., Fatkin, D., Turnpenny, P. D., Kusumi, K., Sillence, D., and Dunwoodie, S. L. (2006) Mutation of the LUNATIC FRINGE gene in humans causes spondylocostal dysostosis with a severe vertebral phenotype, Am. J Hum. Genet. 78, 28-37.

 28.  Aulehla, A., Wehrle, C., Brand-Saberi, B., Kemler, R., Gossler, A., Kanzler, B., and Herrmann, B. G. (2003) Wnt3a plays a major role in the segmentation clock controlling somitogenesis, Dev. Cell 4, 395-406.

 29.  Dubrulle, J., McGrew, M. J., and Pourquie, O. (2001) FGF signaling controls somite boundary position and regulates segmentation clock control of spatiotemporal Hox gene activation, Cell 106, 219-232.

 30.  Evrard, Y. A., Lun, Y., Aulehla, A., Gan, L., and Johnson, R. L. (1998) lunatic fringe is an essential mediator of somite segmentation and patterning, Nature 394, 377-381.

 31.  Zhang, N. and Gridley, T. (1998) Defects in somite formation in lunatic fringe-deficient mice, Nature 394, 374-377.

 32.  Morales, A. V., Yasuda, Y., and Ish-Horowicz, D. (2002) Periodic Lunatic fringe expression is controlled during segmentation by a cyclic transcriptional enhancer responsive to notch signaling, Dev. Cell 3, 63-74.

 33.  Cole, S. E., Levorse, J. M., Tilghman, S. M., and Vogt, T. F. (2002) Clock regulatory elements control cyclic expression of Lunatic fringe during somitogenesis, Dev. Cell 3, 75-84.

 34.  Dale, J. K., Maroto, M., Dequeant, M. L., Malapert, P., McGrew, M., and Pourquie, O. (2003) Periodic notch inhibition by lunatic fringe underlies the chick segmentation clock, Nature 421, 275-278.

 35.  Morimoto, M., Takahashi, Y., Endo, M., and Saga, Y. (2005) The Mesp2 transcription factor establishes segmental borders by suppressing Notch activity, Nature 435, 354-359.

 36.  Conlon, R. A., Reaume, A. G., and Rossant, J. (1995) Notch1 is required for the coordinate segmentation of somites, Development 121, 1533-1545.

 37.  Hrabe de, A. M., McIntyre, J., and Gossler, A. (1997) Maintenance of somite borders in mice requires the Delta homologue DII1, Nature 386, 717-721.

 38.  Kusumi, K., Sun, E. S., Kerrebrock, A. W., Bronson, R. T., Chi, D. C., Bulotsky, M. S., Spencer, J. B., Birren, B. W., Frankel, W. N., and Lander, E. S. (1998) The mouse pudgy mutation disrupts Delta homologue Dll3 and initiation of early somite boundaries, Nat. Genet. 19, 274-278.

 39.  Radtke, F., Wilson, A., Stark, G., Bauer, M., van, M. J., MacDonald, H. R., and Aguet, M. (1999) Deficient T cell fate specification in mice with an induced inactivation of Notch1, Immunity. 10, 547-558.

 40.  Wilson, A., MacDonald, H. R., and Radtke, F. (2001) Notch 1-deficient common lymphoid precursors adopt a B cell fate in the thymus, J Exp. Med. 194, 1003-1012.

 41.  Huang, E. Y., Gallegos, A. M., Richards, S. M., Lehar, S. M., and Bevan, M. J. (2003) Surface expression of Notch1 on thymocytes: correlation with the double-negative to double-positive transition, J Immunol. 171, 2296-2304.

 42.  Koch, U., Lacombe, T. A., Holland, D., Bowman, J. L., Cohen, B. L., Egan, S. E., and Guidos, C. J. (2001) Subversion of the T/B lineage decision in the thymus by lunatic fringe-mediated inhibition of Notch-1, Immunity. 15, 225-236.

 43.  Visan, I., Tan, J. B., Yuan, J. S., Harper, J. A., Koch, U., and Guidos, C. J. (2006) Regulation of T lymphopoiesis by Notch1 and Lunatic fringe-mediated competition for intrathymic niches, Nat. Immunol. 7, 634-643.