Phenotypic Mutation 'oblivious' (pdf version)
Alleleoblivious
Mutation Type nonsense
Chromosome5
Coordinate17,874,966 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Cd36
Gene Name CD36 antigen
Synonym(s) fatty acid translocase, FAT, Scarb3
Chromosomal Location 17,781,690-17,888,959 bp (-)
MGI Phenotype Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart.
Accession Number

NCBI RefSeq: NM_007643; MGI: 107889

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Y340* in Ensembl: ENSMUSP00000080974 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:CD36 12 465 1.1e-142 PFAM
Phenotypic Category immune system, TLR signaling defect: TNF production by macrophages, vision/eye
Penetrance 100% 
Alleles Listed at MGI
All alleles(3) : Targeted, knock-out(2) Chemically induced(1)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17787702 missense possibly damaging 0.92
IGL01355:Cd36 APN 5 17813074 missense possibly damaging 0.79
IGL02140:Cd36 APN 5 17828768 splice site 0.00
IGL02385:Cd36 APN 5 17814719 missense possibly damaging 0.82
IGL02626:Cd36 APN 5 17797128 nonsense probably null 0.00
IGL02645:Cd36 APN 5 17785880 missense possibly damaging 0.66
IGL03149:Cd36 APN 5 17820565 missense probably benign 0.12
E0370:Cd36 UTSW 5 17785749 nonsense probably null
F5770:Cd36 UTSW 5 17820528 frame shift probably null
R0266:Cd36 UTSW 5 17798252 missense probably benign 0.09
R1102:Cd36 UTSW 5 17814213 missense possibly damaging 0.79
R1120:Cd36 UTSW 5 17785828 missense possibly damaging 0.67
R1170:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R1551:Cd36 UTSW 5 17797122 missense probably benign 0.00
R1621:Cd36 UTSW 5 17796991 splice donor site probably benign
R1852:Cd36 UTSW 5 17811236 splice acceptor site probably benign
R1918:Cd36 UTSW 5 17797036 nonsense probably null
R4090:Cd36 UTSW 5 17785720 unclassified probably null
R4197:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R5602:Cd36 UTSW 5 17814792 missense possibly damaging 0.94
R5647:Cd36 UTSW 5 17814765 missense probably damaging 1.00
R5867:Cd36 UTSW 5 17785735 missense probably benign 0.05
V7580:Cd36 UTSW 5 17820528 frame shift probably null
X0020:Cd36 UTSW 5 17797188 splice acceptor site probably benign
Z1088:Cd36 UTSW 5 17795575 unclassified probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Embryos, Sperm, gDNA
MMRRC Submission 010471-UCD
Last Updated 03/28/2017 4:18 PM by Katherine Timer
Record Created unknown
Record Posted 11/08/2007
Phenotypic Description
Figure 1. Responses of oblivious macrophages to various TLR ligands. Wild-type (solid squares), obl/+ (solid triangle) and obl/obl (open circle) macrophages were incubated with various concentration of each ligand. Obl/obl macrophages did not respond normally to the TLR2/6 ligands PGN, MALP-2, but showed normal responses to the TLR2 ligands zymosan and Pam3CSK4, the TLR4 ligand LPS, the TLR7 ligand resiquimod, the TLR9 ligand CpG and the TLR3 ligand poly I:C. Figure reproduced from reference (1).
The oblivious phenotype was identified in a screen of G3 homozygous mutant mice for defective responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1). Peritoneal macrophages from oblivious mice produce reduced (but not absent) amounts of tumor necrosis factor (TNF)-α in response to Mycoplasma pneumoniae macrophage-activating lipopeptide 2 (MALP-2), Staphylococcus aureus lipoteichoic acid (LTA), and peptidoglycan (PGN). The reduced response to MALP-2 is specific for the R-enantiomer of the molecule. In contrast, TNF-α production stimulated by lipopolysaccharide (LPS, TLR4 ligand), resiquimod (TLR7 ligand), poly I:C (TLR3 ligand), CpG ODN (TLR9 ligand), and the TLR2 ligands zymosan, Pam2CSK4 and Pam3CSK4, is normal in oblivious macrophages (1) (Figure 1). Thus, the oblivious locus apparently contributes to (but is not absolutely required for) TLR2-dependent detection of certain lipopeptides, either delivered as pure preparations or present as contaminants in commercial preparations of LTA and PGN.
 
Oblivious mice, like TLR2-deficient mice, are highly susceptible to infection by Staphylococcus aureus (1;2). They accumulate higher levels of bacteria, and die more frequently than wild type mice when infected intravenously (1). By six-to-twelve months, oblivious homozygotes also develop an ocular pterygium (a wing-shaped thickening in the conjunctiva), probably due to an overgrowth of Gram-positive bacteria such as Staphylococcus lentus and Corynebacterium species. Occasionally this opportunistic colonization progresses to more serious infection of the eye (1).
 
Finally, CD4+ but not CD8+ T cell responses to apoptotic cells are abrogated in oblivious mice (3). In this assay, mice are immunized with apoptotic syngeneic cells expressing a membrane-associated ovalbumin peptide. After 8 days, splenocytes are isolated, restimulated with ovalbumin peptide, and antigen-specific CD8+ T cell numbers and CD4+ T cell proliferation are measured. While antigen-specific CD8+ T cell responses are normal, CD4+ T cell proliferation is absent in oblivious mice.

 

Nature of Mutation
The oblivious mutation was mapped to Chromosome 5, and corresponds to a T to A transversion at position 1283 of the Cd36 transcript, in exon 11 of 15 total exons.
 
1266 GAAGGAAAGCCTGTGTATATTTCGCTTCCACAT
335  -E--G--K--P--V--Y--I--S--L--P--H-
 
The mutation creates a premature stop codon at codon 340, resulting in deletion of 133 amino acids from the C terminus of the protein.

 

Protein Prediction
Figure 2. Domain structure of CD36. The oblivious mutation creates a premature stop codon in place of tyrosine at amino acid 340. The positions of cysteines are indicated (C); those in the extracellular domain are labeled C1-C6. Predicted N-linked glycosylation sites are noted with yellow circles. TM, transmembrane domain. This image is interactive; click to view other mutations in Cd36.
There are several alternative CD36 transcripts in which at least six alternative first exons and promoters may be utilized (4;5), in which 5’- and 3’-untranslated exons are alternatively spliced (6;7), or in which middle exons may be skipped (8). Alternative splicing of the first exon is differentially regulated in different tissues (4), but exactly how any of the alternative transcripts are regulated is unknown.
 
The scavenger receptors, named for their involvement in removing foreign or waste molecules from the body, are grouped into classes based on their structure. Class B scavenger receptors, of which the 472 amino acid CD36 is a member, contain two transmembrane domains (Figure 2). The CD36 transmembrane domains (amino acids 7-28 and 439-460) are located at the two termini of the protein, with the ends of the protein (amino acids 1-6 and 461-472) facing inside the cell (9-11). One extracellular loop, 412 amino acids in length, connects the two transmembrane domains, and is predicted to contain ten N-linked glycosylation sites (11;12). Glycosylation at these sites accounts for the discrepancy between the predicted (53 kd) and actual (88 kd) molecular weight of the protein (11;12). The extracellular domain also contains six cysteine residues (C1 to C6) (11). In bovine CD36, these conserved cysteines form disulfide bonds with each other in a 1-3, 2-6, 4-5 arrangement (13). Additionally, two cysteines close to the membrane in each of the cytoplasmic domains may be palmitoylated (14). A putative protein kinase C (PKC) phosphorylation site exists at threonine 92 (in the extracellular domain), and is thought to differentially regulate adhesion to collagen or thrombospondin depending on phosphorylation status (15).
 
The oblivious mutation results in the generation of a stop codon in place of tyrosine 340 that truncates the protein 133 amino acids before the C terminus. The truncation occurs in the extracellular loop. No mutant protein is expressed in homozygous oblivious tissues.
Expression/Localization
Rat Cd36 transcript is detected in most tissues including heart muscle, intestine, spleen, skeletal muscle, adipose tissue and testis, but not in kidney or liver (12). In humans, CD36 is expressed in platelets, monocytes, endothelial cells (including capillary, venular and arteriolar), macrophages (both blood and tissue macrophages), dendritic cells, adipocytes, erythrocytes and some tumor cell lines (11;16-19). Subcellularly, Cd36 is found in caveolae, specialized membrane microdomains that interact with the actin cytoskeleton and concentrate signaling molecules (20).
Background
CD36 (originally called glycoprotein IV) was identified more than 30 years ago as the fourth major glycoprotein of the carbohydrate-rich outer coat of platelets (16). Since then, study has revealed its diverse range of functions and binding partners. These include cell adhesion (via thrombospondin and collagen), fatty acid and lipid transport (by binding long-chain fatty acids and oxidized LDL), clearance of apoptotic cells and antigen presentation. Some of these are discussed below.
 
CD36 was identified as a receptor for thrombospondin-1 (TSP-1) (21;22), an adhesive glycoprotein made and secreted by various cell types and involved in processes including cell adhesion, platelet aggregation, angiogenesis, tumor metastasis and tissue repair (23). Several reports have identified different extracellular regions on CD36 as binding regions for TSP-1 (15;24;25). However, using platelets from patients lacking CD36 (so-called Nak(a)-negative platelets), it was shown that TSP-1 binds to control and Nak(a)-negative platelets similarly (26). It has been postulated that another receptor in close proximity to CD36 is the TSP-1 receptor.
 
CD36 was also found to be a platelet collagen receptor (27). A polyclonal anti-CD36 antibody inhibited platelet adhesion to collagen at early timepoints (0-10 minutes), but not at later times (27). This suggested that CD36 contributes to the initial phase of a biphasic adhesion process. Nak(a)-negative platelets bind to collagen at a slower rate than control platelets in a static setting or in a flowing whole blood system (26;28). However, this result has been disputed by another report in which Nak(a)-negative platelets bound to collagen type I, III or IV with the same rate and magnitude as control platelets (29). It may be that differing experimental conditions (use of collagen from different species, different blood flow rates) contribute to different results, or that Nak(a)-negative platelets can compensate for CD36 deficiency.
 
The human malaria parasite Plasmodium falciparum multiplies within erythrocytes, evading elimination by the spleen by facilitating erythrocyte sequestration in small blood vessels. Infected erythrocytes use the CD36 receptor to bind to endothelial cells of blood vessels, protecting them from circulation and elimination (17;30). Nak(a)-negative platelets do not support adherence of P. falciparum-infected erythrocytes (26). The molecule sequestrin is expressed on malaria-infected cells and has been postulated to mediate binding to endothelial CD36 (31).
 
The fatty acid transporter identified in rat is now known to be CD36, and contributes to long-chain fatty acid (LCFA) transport (12). This has been confirmed by study of the spontaneously hypertensive rat (SHR), for which hypertension, hypertriglyceridemia, reduced HDL phospholipid and defective adipocyte metabolism have been attributed to mutation of CD36 (32). Transgenic overexpression of CD36 in mice reduces blood triglycerides and fatty acids (32), while mice with a targeted deletion of Cd36 have increased levels of cholesterol, fatty acids and triacylglycerol (33). Cd36-/- adipocytes have a decreased ability to transport LCFA (33). CD36 is also a receptor for oxidatively modified LDL (oxLDL) (34), a finding supported by the impaired ability of Cd36-/- peritoneal macrophages to bind and take up oxLDL (33). LDL contributes to the development of atherosclerotic lesions, and Cd36 deficiency protects against these lesions (35).
 
Several human diseases are associated with mutations in CD36 (OMIM 173510, #608404). Interestingly, mutations in CD36 have been found to both protect against (36) and increase susceptibility (37) to malaria. Prader-Willi syndrome (PWS), characterized by an insatiable hunger that results in life-threatening obesity, is correlated with reduced CD36 expression (38). The mechanism by which CD36 contributes to PWS is unknown, but may involve impaired lipid and glucose homeostasis. Finally, similar to Cd36-/- mice, humans with CD36 deficiency also have insulin resistance, hypertriglyceridemia, increased serum LDL cholesterol, and decreased capacity for fatty acid uptake (39-41).
Putative Mechanism
Figure 3. CD36 augments TLR2-mediated ligand recognition. Toll-like receptor 2 (TLR2) signaling pathways. TLR2 associates with TLR6 and TLR1 (not shown) to initiate a MyD88-dependent response that produces proinflammatory cytokines. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information. LTA, lipoteichoic acid; LP2, lipopeptide 2.
Recently, the scavenger receptors, known primarily for their role in binding and internalizing lipoproteins, have received renewed attention for their ability to recognize microbial molecules and thereby contribute to the innate immune response [reviewed in (42)]. Like the TLRs, scavenger receptors bind with high affinity to a diverse range of ligands, and are expressed throughout the body and notably in antigen presenting cells (Figure 3). Several class A scavenger receptors have been shown to bind surface components of Gram-negative and Gram-positive bacteria, and trigger phagocytosis (42). In addition, scavenger receptors, including CD36, have been implicated in clearance of apoptotic cells during development and infection (43). The phagocytosis of apoptotic cells, and consequently cross-presentation, by human immature dendritic cells (iDC) and macrophages in vitro is inhibited by antibodies directed against CD36 (and integrin αvβ5 in the case of iDC), indicating that these receptors play a role in the trafficking of exogenous antigen (44). In Drosophila, the CD36 homologue Croquemort is expressed on macrophages and hemocytes, where it is required for phagocytosis of apoptotic cells (45). However, mouse DC do not use CD36 to mediate cross-presentation, since Cd36-/- DC still cross-present antigen and stimulate antigen-specific CD8+ T cell responses in vivo (46). These data suggest that at least in the mouse, CD36 is not required for uptake of apoptotic cells by DC.
 
The oblivious phenotype supports the contribution of scavenger receptors to the innate immune response, and provides the first evidence that CD36 functions with a TLR to detect microbial molecules. In this context, CD36 is not absolutely required, but augments TLR2-mediated ligand recognition. Mouse Cd36 has been shown to bind to S. aureus and its component LTA, and is required for full phagocytic activity toward the bacterium and subsequent inflammatory cytokine production (47). In agreement with previous reports (46), experiments using oblivious mice indicate that mouse Cd36 is not required for uptake and cross-presentation of apoptotic cell antigens to CD8+ T cells, although distinct DC subsets may have different receptor requirements that remain untested.
Primers Primers cannot be located by automatic search.
Genotyping

Oblivious genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 
PCR Primer Sequences
Oblvious_PCR_F: 5'-ACAGACCTCAGAGTCCTCCTTGTTG-3'
Oblvious_PCR_R: 5'-GCCATCATTTGGAAGAGAGACCCC-3'
 
Sequencing Primers
Oblivious_Seq_F: 5'-CTGGCTGCTTAAAATGTCACAGAG-3'
Oblivious_Seq_R: 5'-AAGAGAGACCCCTTGGTCTTC-3'
 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C             

 
The following sequence of 1052 nucleotides (from Genbank genomic region NC_000071.6 for linear genomic sequence of Cd36) is amplified:
92713              acagacct cagagtcctc cttgttgtgt ttgtatttac tgtagaataa
92761 ggaggataag gaatagcaaa ctatgagatg ttcagtgtag ttgtatcatc acttgaagtt
92821 tgaacatgtt ctaatttggt tcaacagtga acatttgaat tctagaaatt agtatgaaga
92881 aataaaaact ggctgcttaa aatgtcacag agttttatgt tattttgcat aataataacc
92941 acatgtaatg ctcttatcag catttctttt tgtttgtttg tttgtttttg tttttgtttt
93001 ttgagacagg gtttctctgt atagccctgg ctatcctgga actcactctg tagaccaggc
93061 tggcctcgaa ctcagaaatc tgcctgcctc tgcctcccta atgctgggat taaaggcatg
93121 caccaccaag cttggcttta tcagcatttc aaaaacaact atatcttaat ctacaaaagc
93181 ttcacacttt agtaaatatt ttaaataatt tatgagtgat aaaataatcc atttccaatt
93241 gtcttttaaa atgtgtcttc aggaaagcct gtgtatattt cgcttccaca tttcctacat
93301 gcaagtccag atgtttcaga acctattgaa ggcttacatc caaatgaaga tgagcatagg
93361 acatacttag atgtggaacc cgtaagtcac tctcttattg atgaatttag ttaatattct
93421 tctaaaataa aaaatatata tacattcttg gatcatatcc ttaatatgag tgaaactatc
93481 aaggagaata aaacttattt cttcctattc tgatggataa atggcatgaa attcagattt
93541 ggtttcaata caaggaactt cataaatttt tttcttttct ttttttttaa attaggtatt
93601 ttcttcattt acatttcaaa tgctatccca aaagtccccc ataccctacc cccccacaca
93661 cacactcccc taactaccca ctctcacttc ttggccctgg cattcccctg tactgaggca
93721 tttaaagttt ggaagaccaa ggggtctctc ttccaaatga tggc

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.


Oblivious mice can also be phenotyped to assess homozygosity by measuring CD36 expression on platelets or monocytes collected from blood (1). Homozygote animals show a complete lack of CD36 expression, whereas heterozygotes show a reduced expression relative to wildtype expression and isotype background staining. The protocol involves a two-step antibody detection of CD36 on the surface of monocytes or platelets; analysis is performed using flow cytometry.
 
First antibody: mouse anti-mouse CD36 (Chemicon, Mab1258) 1:100 dilution.
 
Secondary antibody; PE-conjugated anti-mouse IgA (e-Bioscience, San Diego)   1:100 dilution (can use any fluorescent label).
 
Optional: specific antibodies can be used to detect platelets/or monocytes.
 
Example:
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsKasper Hoebe, Bruce Beutler
Edit History
04/07/2011 10:24 AM (current)
04/07/2011 9:33 AM
04/07/2011 9:32 AM
09/08/2010 10:09 AM
02/03/2010 4:55 PM