Phenotypic Mutation 'slim'

• Allele: slim
• Mutation Type: nonsense
• Chromosome: 16
• Coordinate: 3,808,774 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Slx4
• Gene Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
• Synonym(s): D16Bwg1016e, Btbd12
• Chromosomal Location: 3,796,969-3,821,634 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000038871]
• AlphaFold: Q6P1D7
• SMART Domains: Protein: ENSMUSP00000038871; Gene: ENSMUSG00000039738; AA Change: Q389*

Domain	Start	End	E-Value	Type
low complexity region	400	413	N/A	INTRINSIC
BTB	506	609	6.15e-7	SMART
low complexity region	651	667	N/A	INTRINSIC
low complexity region	833	849	N/A	INTRINSIC
low complexity region	857	875	N/A	INTRINSIC
low complexity region	1176	1192	N/A	INTRINSIC
low complexity region	1437	1461	N/A	INTRINSIC
Pfam:Slx4	1484	1541	3e-17	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000126423; Gene: ENSMUSG00000039738

Domain	Start	End	E-Value	Type
Pfam:BTB	6	102	6.7e-14	PFAM

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-08-06 9:26 AM by Bruce Beutler
• Record Posted: 2016-09-27
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Zhe Chen and Bruce Beutler

Accession Number

NCBI RefSeq: NM_177472; MGI:106299

Alleles Listed at MGI

All Mutations and Alleles(6) : Gene trapped(1) Targeted(5)

Phenotypic Description

Figure 1. Slim mice exhibit reduced body weights compared to control littermates. WGT data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The slim phenotype was identified among G3 mice of the pedigree R1083, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R1083. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The body weight phenotype was linked to a mutation in Slx4: a C to T transition at base pair 3,990,910 (v38) on chromosome 16, or base pair 12,920 in the GenBank genomic region NC_000082 encoding Slx4. Linkage was found with a recessive model of inheritance (P = 9.211 x 10^-6), wherein six variant homozygotes departed phenotypically from 21 homozygous reference mice and 28 heterozygous mice (Figure 2).

The mutation corresponds to residue 1,473 in the NM_177472 mRNA sequence in exon 7 of 15 total exons. 

1458 CCTTCCAAGGAACCCCAGCTACCATTGGAGCTG 384  -P--S--K--E--P--Q--L--P--L--E--L-

The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine (Q) 389 for a premature stop codon (Q389*) in the SLX4 protein.

Protein Prediction

Figure 3. Domain organization of SLX4. Abbreviations: UBZ, ubiquitin-binding C2HC-type zinc finger; MLR, MEI9^XPF interaction-like region; BTB, Broad-Complex, Tramtrack and Bric a brac/POxvirus and Zinc finger; SAP,  SAF-A/B, Acinus and PIAS motif; SBD, SLX1 binding domain. The location of the slim mutation is indicated.

Slx4 encodes structure-specific endonuclease subunit 4 (SLX4; alternatively, BTB/POX domain-containing protein 12 [BTBD12] or Fanconi Anemia Complementation Group P [FANCP]). SLX4 has two N-terminal ubiquitin-binding C2HC-type zinc finger (UBZ) domains, a MEI9^XPF interaction-like region (MLR), a Broad-Complex, Tramtrack and Bric a brac/POxvirus and Zinc finger (BTB/POZ) protein-protein interaction domain (amino acids 506-609), a SAF-A/B, Acinus and PIAS (SAP) motif, a SLX1 binding domain (SBD; amino acids 1484-1541), and a highly conserved C-terminal domain that contains a helix-turn-helix motif (Figure 3) (1).

SLX4 interacts with several proteins necessary for its function. The MLR domain mediates the interaction between SLX4 with the DNA repair endonuclease complex XPF-ERCC1, the SAP domain of SLX4 binds the endonuclease complex MUS81-EME1, and the SBD domain binds the SLX1 endonuclease (see the Background section for more details) (2;3). SLX4 also binds the mismatch repair recognition complex MSH2-MSH3, the PLK1 cell cycle control kinase, and SLX4IP (1;4;5). The UBZ domains mediate an interaction between SLX4 and ubiquitinylated FANCD2 (6). The UBZ domains are required for the FANCD2-mediated recruitment of SLX4 to DNA-interstrand crosslink (ICL)-induced DNA damage foci (6;7). ICL is a type of DNA damage that links two strands of DNA, subsequently inhibiting transcription and replication (8). Mutation of the UBZ domain causes selective sensitivity to ICL-inducing agents (6). Deletion of the UBZ domain resulted in an inability of SLX4 to be recruited to the sites of ICL induction (9). The first UBZ domain of SLX4, but not the second, binds to ubiquitin polymers (9). Although not required for ICL repair or the binding of ubiquitin, the second UBZ domain is required for the resolution of Holliday junctions (9).

Human SLX4 has a TRF2-binding motif (TBM; H¹⁰²⁰-X-L¹⁰²²-X-P¹⁰²⁴) within an unstructured region of the protein after the BTB domain (3;10). TRF2 is a subunit of the telomere TRF2-RAP1 shelterin subcomplex and mediates the recruitment of SLX4 to telomeres (10). TRF2 is not essential for SLX4 localization to the sites of DNA damage or for the ability of SLX4 to promote DNA repair (10). Some mammals have a motif similar to the TBM, but the TBM-like motifs are not predicted to interact with TRF2 (11).

SLX4 undergoes several posttranslational modifications. SLX4 has three small ubiquitin-like modifier (SUMO)-interacting motifs (SIMs): VILLL, VIDV, and VVEV (in mouse) corresponding to amino acids 956-960, 997-1000, and 1180-1183, respectively (12-14). The SIMs and the BTB domain mediate the SUMOylation of SLX4 (12). The SIM domains putatively facilitate the recruitment of SLX4 to DNA damage sites where it subsequently enhanced interactions with known SUMOylated targets including RPA70. The SIM motifs also promote SLX4 recruitment to telomeres (13). Cells expressing a SLX4 SIM mutant are sensitive to DNA damage and exhibit increased common fragile site instability as well as increased frequency of metaphase breaks, micronuclei, and 53BP1 nuclear bodies (15). Furthermore, the SLX4 SIM mutant is not recruited to promyelotic leukemia (PML) nuclear bodies or stabilized at laser-induced DNA damage sites (14). PARylation (i.e., the binding of PARP1) of SLX4 is also required for recruitment of SLX4 to sites of DNA damage (14). Yeast SLX4 is phosphorylated by the Mec1 and Tel1 kinases in response to DNA damage and during all cell cycle stages (16;17). SLX4 phosphorylation is essential for single-strand annealing yeast cells. The function of phosphorylation of SLX4 in mammalian cells is unknown.

The slim mutation results in substitution of Q389 for a premature stop codon (Q389*). Q389 is in the vicinity of the MLR domain. Expression of SLX4^slim has not been examined.

Expression/Localization

SLX4 is ubiquitously expressed. SLX4 localizes to telomeres in human cells; however mouse SLX4 does not (10). SLX4 associates with telomeres throughout the cell cycle, but this interaction is at a maximum level during late S phase and under cell conditions of genotoxic stress (18).

Background

Figure 4. SLX4 promotes DNA lesion-specific responses. (Left & middle) Stalling of replication forks on DNA interstrand crosslinks (ICLs) induces lesion recognition by the FANCM–FAAP24–MHF1–MHF2 complex (not shown) and subsequent recruitment of the Fanconi anaemia core complex. A consequence of activation of the Fanconi anaemia core complex is the monoubiquitylation of the FANCD2–FANCI (FANCD2–I) heterodimer. Ubiquitylated FANCD2 is directed to the ICL region, where it functions as a landing pad for the recruitment of several factors, including SLX4 and Fanconi-associated nuclease 1 (FAN1), and coordinates nucleolytic incisions that are probably mediated by ERCC4 (a structure-specific endonuclease that also functions in nucleotide excision repair) and possibly MUS81. Ligation restores an intact DNA duplex, which functions as a template for homologous recombination-mediated repair of the double-strand break (DSB). The DNA incisions create a DSB, which is further processed by nucleases such as CtBP-interacting protein (CtIP), MRN (MRE11–RAD50–NBS1), exonuclease 1 (EXO1) and the helicase–nuclease complex BLM–DNA2 (Bloom syndrome protein–DNA replication ATP-dependent helicase/nuclease 2) that create a single-stranded DNA (ssDNA) overhang. This ssDNA coated with replication protein A (RPA) is a substrate for RAD51-mediated strand invasion promoted by BRCA2 and subsequent homologous recombination. The USP1–UAF1 (ubiquitin carboxyl-terminal hydrolase 1– USP1-associated factor 1) complex deubiquitylates the FANCD2–I heterodimer and completes repair. Figure legend adapted from Ceccaldi et al (2016) . (Right) The SIMs promote SLX4 SUMO E3 ligase activity and ability to interact with SUMO-modified target proteins, facilitating cellular responses to replication-associated stress

Structure-specific endonucleases (SSEs) catalyze most forms of DNA cleavage during DNA repair. SLX4 has several functions in the maintenance of genome stability, including promoting DNA ICL, Holliday junction resolution, restoration of stalled replication forks, and telomere maintenance by regulating SSEs (1;19). SLX4 is a component of the scaffold that promotes the assembly of multiprotein complexes containing enzymes for DNA maintenance and repair. The SLX4 complex is recruited to sites of DNA repair and facilitates the repair of 3’ flaps, 5’ flaps, and replication fork structures.

During ICL repair, the MUS81-EME1 heterodimer catalyzes nick incision on the template strands at the site of DNA replication fork machinery stall, resulting in a one-ended double-strand break with a 3’ ssDNA overhang. SLX4 interacts with MUS81-EME1, but is not required for ICL-induced DSB formation (Figure 4) (5;20). DNA double helix unwinding occurs adjacent to the ICL with the assistance of the TFIIH complex comprised of ERCC3/XPB, ERCC2/XPD DNA helicases, and several other factors. There is a subsequent incision 3’ and 5’ of the ICL and then displacement of the ICL from the double helix. The endonuclease complex XPF-ERCC1 creates a nick incision 5’ of the DNA lesion.

Holliday junctions occur at the last step of homologous recombination during DNA double strand break repair and restoration of stalled replication forks. Holliday junction processing is essential for the completion of DNA repair as well as for chromosome segregation during mitosis. SLX4-SLX1 is one of three nucleases (the others being GEN1 and MUS81-EME1) that resolve Holliday junctions (21;22). Cells that do not express SLX1/4, MUS81, or GEN1 pathway-associated proteins exhibit defects in chromosome segregation and reduced survival (21). Upon cyclin-dependent kinase-mediated phosphorylation, SLX1-SLX4 and MUS81-EME1 associate to form a SLX-MUS holoenzyme at the G2/M transition. The SLX-MUS holoenzyme functions as a Holliday junction resolvase (21).

SLX4 localizes to telomeres through an interaction with TRF2 (3;4;10). TRF2 negatively regulates the length of telomeres (23;24). Upon association with TRF2, SLX4 transports SLX1 to the telomere. SLX4 is required for the nucleolytic resolution of branched intermediates during telomere replication (18). Loss of the interaction between SLX4 and TRF2 or SLX1 results in telomere fragility (18). SLX4 prevents telomere fragility in the absence and presence of exogenous replication stress. SLX4 prevents DNA damage at telomeres as loss of SLX4 in mouse and human cells resulted in an increased rate of telomere dysfunction-induced foci as well as increased telomere length (10). A function for SLX4 in telomere trimming is the result of its interaction with SLX1; a SLX4 mutant unable to interact with SLX1 failed to restore telomere length. SLX1 promoted the cleavage of telomeric D-loop (3).  

SLX4 functions as a SUMO E3 ligase that is able to SUMOlyate itself as well as the XPF subunit of the XPF-ERCC1 endonuclease (Figure 4) (12). SLX4 interacts with the SUMO-associated E2 conjugating enzyme UBC9. The SUMOylation activity of SLX4 is stimulated in vitro by DNA and is SLX4 phosphorylation-dependent. SLX4-associated SUMOylation is not required for ICL repair, but is associated with SLX4 overexpression-associated cellular toxicity. SLX4-associated SUMOylation is toxic by promoting DSBs in response to global replication stress.

SLX4 is required for Mec1-mediated phosphorylation of Rtt107, a BRCA1 C-terminal domain protein that assists in recovery from DNA damage during the S phase of the cell cycle (25). SLX4-dependent Rtt107 phosphorylation is essential for replication restart after alkylation damage. The function of SLX4 in promoting Rtt107 phosphorylation is independent of its function in the SLX1-SLX4 complex. SLX4 is recruited to chromatin behind stressed replication forks; the location of SLX4 recruitment is distinct from the area in which the replication machinery binds. SLX4 complex formation is nucleated by Mec1-mediated phosphorylation of histone H2A, which is then recognized by Rtt107. SLX4 promotes the recruitment of the Mec1 activator Dbp11 behind the stressed replication forks (26). Yeast cells depleted of either Rtt107 or SLX4 exhibited genome instability, sensitivity to DNA replication stress, and inability to complete DNA replication during recovery from replication stress (26).

Mutations in SLX4 are linked to Fanconi anemia, complementation group P (FANCP; OMIM: #613951), an autosomal disorder characterized by increased chromosomal instability and early-onset bone marrow failure (27). Some patients also have skeletal anomalies, chromosome instability, hypersensitivity to DNA crosslinking agents, and a predisposition to cancer (20;27).

Putative Mechanism

Slx4-deficient (Slx4^-/-) mice are born at sub-Mendelian ratios (frequency of homozygotes was 11%) and have reduced fertility due to gonad dysfunction (28). Ovaries from female Slx4^-/- mice did not have oocytes, and the testes from male exhibited failure of spermatogenesis. Several mutant mice exhibited perinatal lethality. Surviving mutant mice exhibited growth retardation compared to wild-type littermates, domed skulls, ocular anomalies, and blood cytopenia (28). Cells derived from the Slx4^-/- mice showed premature senescence, accumulation of damaged chromosomes, and sensitivity to DNA crosslinking agents. Slx4^-/- mice develop epithelial cancers and a contracted hematopoietic stem cell pool (29). The low body weight phenotype in the slim mice indicates loss of SLX4^slim function. No other obvious phenotypes were observed in the slim mice.

Primers

PCR Primer
slim_pcr_F: TGCCAAGTCCACAAGGTCCTGAAG
slim_pcr_R: TGGAACCTGCATCCTGCATACAAAC

Sequencing Primer
slim_seq_F: TCCTGAAGGGCTTGACGC
slim_seq_R: TTCACCTAAATGGGCGACTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 447 nucleotides is amplified (chromosome 16, - strand):

1   tggaacctgc atcctgcata caaactacat acaactgcta gatgtaagtt gatattcacc
61  taaatgggcg actgattcca ggggaccctt ctgataactg gccctcctgt acacttgagg
121 gcatcaggta gacctgagct ataacagaag ctgccaacac agtttcccag gctgctcctg
181 gttgtgagct tagccctgtc ctagctgtgc atgtgtagga tggtttggga gattatgtgt
241 cggtgacaat aaccacccag tcactagcta ttcaacttct ttcaggaacc ccagctacca
301 ttggagctgc ccaagcaagg agagccgagt ccacggcggc cacctgcttc ccagagcagc
361 cttcctgtga gccacagccc caagatccgg ctgctgtcct ccagccagag ggagcgtcaa
421 gcccttcagg accttgtgga cttggca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Fekairi, S., Scaglione, S., Chahwan, C., Taylor, E. R., Tissier, A., Coulon, S., Dong, M. Q., Ruse, C., Yates, J. R.,3rd, Russell, P., Fuchs, R. P., McGowan, C. H., and Gaillard, P. H. (2009) Human SLX4 is a Holliday Junction Resolvase Subunit that Binds Multiple DNA repair/recombination Endonucleases. Cell. 138, 78-89.

  2. Kim, Y., Spitz, G. S., Veturi, U., Lach, F. P., Auerbach, A. D., and Smogorzewska, A. (2013) Regulation of Multiple DNA Repair Pathways by the Fanconi Anemia Protein SLX4. Blood. 121, 54-63.

  3. Wan, B., Yin, J., Horvath, K., Sarkar, J., Chen, Y., Wu, J., Wan, K., Lu, J., Gu, P., Yu, E. Y., Lue, N. F., Chang, S., Liu, Y., and Lei, M. (2013) SLX4 Assembles a Telomere Maintenance Toolkit by Bridging Multiple Endonucleases with Telomeres. Cell Rep. 4, 861-869.

  4. Svendsen, J. M., Smogorzewska, A., Sowa, M. E., O'Connell, B. C., Gygi, S. P., Elledge, S. J., and Harper, J. W. (2009) Mammalian BTBD12/SLX4 Assembles a Holliday Junction Resolvase and is Required for DNA Repair. Cell. 138, 63-77.

  5. Munoz, I. M., Hain, K., Declais, A. C., Gardiner, M., Toh, G. W., Sanchez-Pulido, L., Heuckmann, J. M., Toth, R., Macartney, T., Eppink, B., Kanaar, R., Ponting, C. P., Lilley, D. M., and Rouse, J. (2009) Coordination of Structure-Specific Nucleases by Human SLX4/BTBD12 is Required for DNA Repair. Mol Cell. 35, 116-127.

  6. Yamamoto, K. N., Kobayashi, S., Tsuda, M., Kurumizaka, H., Takata, M., Kono, K., Jiricny, J., Takeda, S., and Hirota, K. (2011) Involvement of SLX4 in Interstrand Cross-Link Repair is Regulated by the Fanconi Anemia Pathway. Proc Natl Acad Sci U S A. 108, 6492-6496.

  7. Kim, H., and D'Andrea, A. D. (2012) Regulation of DNA Cross-Link Repair by the Fanconi anemia/BRCA Pathway. Genes Dev. 26, 1393-1408.

  8. Deans, A. J., and West, S. C. (2011) DNA Interstrand Crosslink Repair and Cancer. Nat Rev Cancer. 11, 467-480.

  9. Lachaud, C., Castor, D., Hain, K., Munoz, I., Wilson, J., MacArtney, T. J., Schindler, D., and Rouse, J. (2014) Distinct Functional Roles for the Two SLX4 Ubiquitin-Binding UBZ Domains Mutated in Fanconi Anemia. J Cell Sci. 127, 2811-2817.

  10. Wilson, J. S., Tejera, A. M., Castor, D., Toth, R., Blasco, M. A., and Rouse, J. (2013) Localization-Dependent and -Independent Roles of SLX4 in Regulating Telomeres. Cell Rep. 4, 853-860.

  11. Chen, Y., Yang, Y., van Overbeek, M., Donigian, J. R., Baciu, P., de Lange, T., and Lei, M. (2008) A Shared Docking Motif in TRF1 and TRF2 used for Differential Recruitment of Telomeric Proteins. Science. 319, 1092-1096.

  12. Guervilly, J. H., Takedachi, A., Naim, V., Scaglione, S., Chawhan, C., Lovera, Y., Despras, E., Kuraoka, I., Kannouche, P., Rosselli, F., and Gaillard, P. H. (2015) The SLX4 Complex is a SUMO E3 Ligase that Impacts on Replication Stress Outcome and Genome Stability. Mol Cell. 57, 123-137.

  13. Ouyang, J., Garner, E., Hallet, A., Nguyen, H. D., Rickman, K. A., Gill, G., Smogorzewska, A., and Zou, L. (2015) Noncovalent Interactions with SUMO and Ubiquitin Orchestrate Distinct Functions of the SLX4 Complex in Genome Maintenance. Mol Cell. 57, 108-122.

  14. Gonzalez-Prieto, R., Cuijpers, S. A., Luijsterburg, M. S., van Attikum, H., and Vertegaal, A. C. (2015) SUMOylation and PARylation Cooperate to Recruit and Stabilize SLX4 at DNA Damage Sites. EMBO Rep. 16, 512-519.

  15. Lukas, C., Savic, V., Bekker-Jensen, S., Doil, C., Neumann, B., Pedersen, R. S., Grofte, M., Chan, K. L., Hickson, I. D., Bartek, J., and Lukas, J. (2011) 53BP1 Nuclear Bodies Form Around DNA Lesions Generated by Mitotic Transmission of Chromosomes Under Replication Stress. Nat Cell Biol. 13, 243-253.

  16. Flott, S., and Rouse, J. (2005) Slx4 Becomes Phosphorylated After DNA Damage in a Mec1/Tel1-Dependent Manner and is Required for Repair of DNA Alkylation Damage. Biochem J. 391, 325-333.

  17. Flott, S., Alabert, C., Toh, G. W., Toth, R., Sugawara, N., Campbell, D. G., Haber, J. E., Pasero, P., and Rouse, J. (2007) Phosphorylation of Slx4 by Mec1 and Tel1 Regulates the Single-Strand Annealing Mode of DNA Repair in Budding Yeast. Mol Cell Biol. 27, 6433-6445.

  18. Sarkar, J., Wan, B., Yin, J., Vallabhaneni, H., Horvath, K., Kulikowicz, T., Bohr, V. A., Zhang, Y., Lei, M., and Liu, Y. (2015) SLX4 Contributes to Telomere Preservation and Regulated Processing of Telomeric Joint Molecule Intermediates. Nucleic Acids Res. 43, 5912-5923.

  19. Castor, D., Nair, N., Declais, A. C., Lachaud, C., Toth, R., Macartney, T. J., Lilley, D. M., Arthur, J. S., and Rouse, J. (2013) Cooperative Control of Holliday Junction Resolution and DNA Repair by the SLX1 and MUS81-EME1 Nucleases. Mol Cell. 52, 221-233.

  20. Stoepker, C., Hain, K., Schuster, B., Hilhorst-Hofstee, Y., Rooimans, M. A., Steltenpool, J., Oostra, A. B., Eirich, K., Korthof, E. T., Nieuwint, A. W., Jaspers, N. G., Bettecken, T., Joenje, H., Schindler, D., Rouse, J., and de Winter, J. P. (2011) SLX4, a Coordinator of Structure-Specific Endonucleases, is Mutated in a New Fanconi Anemia Subtype. Nat Genet. 43, 138-141.

  21. Wyatt, H. D., Sarbajna, S., Matos, J., and West, S. C. (2013) Coordinated Actions of SLX1-SLX4 and MUS81-EME1 for Holliday Junction Resolution in Human Cells. Mol Cell. 52, 234-247.

  22. Svendsen, J. M., and Harper, J. W. (2010) GEN1/Yen1 and the SLX4 Complex: Solutions to the Problem of Holliday Junction Resolution. Genes Dev. 24, 521-536.

  23. Ancelin, K., Brunori, M., Bauwens, S., Koering, C. E., Brun, C., Ricoul, M., Pommier, J. P., Sabatier, L., and Gilson, E. (2002) Targeting Assay to Study the Cis Functions of Human Telomeric Proteins: Evidence for Inhibition of Telomerase by TRF1 and for Activation of Telomere Degradation by TRF2. Mol Cell Biol. 22, 3474-3487.

  24. Smogorzewska, A., van Steensel, B., Bianchi, A., Oelmann, S., Schaefer, M. R., Schnapp, G., and de Lange, T. (2000) Control of Human Telomere Length by TRF1 and TRF2. Mol Cell Biol. 20, 1659-1668.

  25. Roberts, T. M., Kobor, M. S., Bastin-Shanower, S. A., Ii, M., Horte, S. A., Gin, J. W., Emili, A., Rine, J., Brill, S. J., and Brown, G. W. (2006) Slx4 Regulates DNA Damage Checkpoint-Dependent Phosphorylation of the BRCT Domain Protein Rtt107/Esc4. Mol Biol Cell. 17, 539-548.

  26. Balint, A., Kim, T., Gallo, D., Cussiol, J. R., Bastos de Oliveira, F. M., Yimit, A., Ou, J., Nakato, R., Gurevich, A., Shirahige, K., Smolka, M. B., Zhang, Z., and Brown, G. W. (2015) Assembly of Slx4 Signaling Complexes Behind DNA Replication Forks. EMBO J. 34, 2182-2197.

  27. Kim, Y., Lach, F. P., Desetty, R., Hanenberg, H., Auerbach, A. D., and Smogorzewska, A. (2011) Mutations of the SLX4 Gene in Fanconi Anemia. Nat Genet. 43, 142-146.

  28. Crossan, G. P., van der Weyden, L., Rosado, I. V., Langevin, F., Gaillard, P. H., McIntyre, R. E., Sanger Mouse Genetics Project, Gallagher, F., Kettunen, M. I., Lewis, D. Y., Brindle, K., Arends, M. J., Adams, D. J., and Patel, K. J. (2011) Disruption of Mouse Slx4, a Regulator of Structure-Specific Nucleases, Phenocopies Fanconi Anemia. Nat Genet. 43, 147-152.

  29. Hodskinson, M. R., Silhan, J., Crossan, G. P., Garaycoechea, J. I., Mukherjee, S., Johnson, C. M., Scharer, O. D., and Patel, K. J. (2014) Mouse SLX4 is a Tumor Suppressor that Stimulates the Activity of the Nuclease XPF-ERCC1 in DNA Crosslink Repair. Mol Cell. 54, 472-484.