Phenotypic Mutation 'Sisyphus'

• Allele: Sisyphus
• Mutation Type: missense
• Chromosome: 13
• Coordinate: 52,794,826 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Syk
• Gene Name: spleen tyrosine kinase
• Synonym(s): Sykb
• Chromosomal Location: 52,737,209-52,802,828 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010] ; PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000060828] [ENSMUSP00000112914] [ENSMUSP00000113852]
• AlphaFold: P48025
• SMART Domains: Protein: ENSMUSP00000060828; Gene: ENSMUSG00000021457; AA Change: Y520C

Domain	Start	End	E-Value	Type
SH2	12	97	4.51e-26	SMART
SH2	165	249	5.06e-29	SMART
TyrKc	365	620	7.61e-120	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000055087)
• SMART Domains: Protein: ENSMUSP00000112914; Gene: ENSMUSG00000021457; AA Change: Y497C

Domain	Start	End	E-Value	Type
SH2	12	97	4.51e-26	SMART
SH2	165	249	5.06e-29	SMART
TyrKc	342	582	2.68e-106	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000118756)
• SMART Domains: Protein: ENSMUSP00000113852; Gene: ENSMUSG00000021457; AA Change: Y520C

Domain	Start	End	E-Value	Type
SH2	12	97	4.51e-26	SMART
SH2	165	249	5.06e-29	SMART
TyrKc	365	620	7.61e-120	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000120135)
• Meta Mutation Damage Score: 0.9511
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Sperm, gDNA
• Last Updated: 2020-01-15 10:21 AM by Eva Marie Y. Moresco
• Record Created: 2015-09-02 8:28 AM
• Record Posted: 2015-12-11
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jeff SoRelle, Hexin Shi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_011518 (variant 1), NM_001198977 (variant 2); MGI:99515

Alleles Listed at MGI

All Mutations and Alleles(22) : Chemically induced (ENU)(1) Gene trapped(6) Targeted (15)

Phenotypic Description

Figure 1. Sisyphus mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sisyphus mice exhibited increased IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Sisyphus phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1888, some of which exhibited increased frequencies of natural killer cells in the peripheral blood (Figure 1). Some mice also exhibited increased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment, indicative of enhanced NLRP3 inflammasome function (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the increased frequency of peripheral NK cells using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 98 mutations (X-axis) identified in the G1 male of pedigree R1888. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 98 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Syk:  an A to G transition at base pair 52,640,790 (v38) on chromosome 13, or base pair 59,535 in the GenBank genomic region NC_000079 encoding the Syk gene. The strongest association was found with a dominant model of linkage to the normalized frequency of NK cells, wherein nine heterozygous mice departed phenotypically from 14 homozygous reference mice with a P value of 4.134 x 10^-7 (Figure 3).  

The mutation corresponds to residue 1,775 in the mRNA sequence NM_011518 within exon 11 of 14 total exons and residue 1,771 in the mRNA sequence NM_001198977 within exon 11 of 14 total exons.

1759 GCTGATGAAAACTACTACAAGGCCCAGACCCAC NM_011518 (variant 1) 1755 GCTGATGAAAACTACTACAAGGCCCAGACCCAC NM_001198977 (variant 2) 515  -A--D--E--N--Y--Y--K--A--Q--T--H-

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at position 520 (Y520C) in the Syk protein, and is predicted by PolyPhen-2 to be probably benign (score = 0.045) (1).

Protein Prediction

Figure 4. Domain structure of Syk. Mouse Syk consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). Aspartic acid (D) 488 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues are autophosphorylated following BCR stimulation. The Sisyphus mutation causes a tyrosine to cysteine change at amino acid 520. This image is interactive; click to view another mutation in Syk.

Figure 5. Crystal structure of the kinase domain of human Syk. Protein structure modeled from PDB: 1XBA using UCSF Chimera. Please see the entry for poppy for more details about the structure. The location of the Sisyphus mutation is labeled. The active site is also labeled. Click the image to rotate.

Figure 6. Crystal structure of full-length human Syk. Protein structure modeled from PDB:4FL3 and (41) using UCSF Chimera. Please see the text for more details about the structure. The equivalent location of the Sisyphus mutation is labeled. Click the image to rotate.

Syk encodes spleen tyrosine kinase (Syk), one of two members of the Syk family of cytosolic protein kinases. Syk has two Src homology 2 (SH2) domains and a C-terminal kinase region followed by a short C-terminal tail [Figures 4-6; reviewed in (2-4)]. Between the SH2 domains is interdomain A; between the C-terminal SH2 domain and the kinase domain is interdomain B [(5); reviewed in (2-4)]. Interdomain A facilitates the proper conformation of the SH2 domains to promote binding to phosphorylated ITAMs using a helical coiled-coil structure. Interdomain B contains five putative autophosphorylation sites and functions to recruit, and dock, downstream signaling proteins (e.g., phospholipase Cγ1 (PLCγ1), Vav1 and c-Cbl) as well as regulate the ability of Syk to bind to ITAMs. The Sisyphus mutation results in a tyrosine to cysteine substitution at amino acid 520 within the Syk kinase domain. 

For more information about Syk, please see the record for poppy.

Putative Mechanism

Syk plays a major role in B cell development as a component of the pre-B cell receptor (BCR) and BCR signaling pathway. In BCR signaling, following the aggregation of BCR molecules, the ITAMs in the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) (6;7). These phosphotyrosines then act as docking sites for the SH2 domains of Syk, resulting in Syk phosphorylation and activation. Syk phosphorylates a number of downstream targets including BLNK (see the record for busy), PLCγ2 (see the record for queen), and protein kinase C β (PKCβ; see the record for Untied). BCR-associated signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for puff, xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (8)]. Syk couples pre-BCR and BCR activation to downstream signaling pathways that mediate B cell development, proliferation, and survival. In addition to its role in BCR signaling, Syk also functions in pre-TCR signaling in thymocytes during the transition from the DN3 to the DN4 stage of development (9), and during TCR signaling in mature T cell populations (intraepithelial γδ T cells and naïve αβ T cells) (10;11). Syk functions in ITAM-associated signaling in other immune cells including natural killer cells downstream from the FcγRIII receptor (12), in mast cells downstream from the FcεRI receptor (13), and in neutrophils and macrophages downstream from FcγR signaling, which trigger several cellular responses including proliferation, differentiation, cell survival, mast cell degranulation, reactive oxygen species (ROS) production, phagocytosis, and cytokine release [(14;15); reviewed in (2;4)].

Fc receptor-mediated myeloid functions and β2 integrin-mediated leukocyte activation both require Syk and are linked to the pathogenesis of rheumatoid arthritis. In humans, defects in Syk-associated signaling are linked to autoimmune and allergic diseases such as rheumatoid arthritis, asthma, and allergic rhinitis (16-18). Syk-deficient mice exhibited perinatal lethality with a concomitant defect in blood vessel morphology, dilated vasculature, and systemic hemorrhage in the embryo (19-22). Homozygous Sisyphus mice are not born at expected Mendalian ratios, indicating that Syk^Sisyphus does not retain sufficient functionality to support survival. Tyr519 and Tyr520 are autophosphorylated following Syk binding to phosphorylated ITAMs. Phosphorylation of Tyr519 and Tyr520 is required for Syk signal transduction, although it is not absolutely required for Syk kinase activity (23;24).  Activation loop autophosphorylation sustains Syk signaling after transient ITAM phosphorylation ends (25).

Altogether, the phenotypes of the Sisyphus mice indicate that Syk^Sisyphus exhibits loss of function.

Primers

PCR Primer
Sisyphus_pcr_F: CGTGTGATTCTAGGCACATTAAGG
Sisyphus_pcr_R: TCTCCAAGGTTACTAGTGAGATTTC

Sequencing Primer
Sisyphus_seq_F: GATAAGAACATCATAGAGCTGGTTC
Sisyphus_seq_R: CTACCATAGTAAAATACAGAGAGCAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 416 nucleotides is amplified (chromosome 13, + strand):

1   cgtgtgattc taggcacatt aaggataaga acatcataga gctggttcac caggtttcca
61  tggggatgaa gtatttggaa gagagcaact ttgtgcacag agatctggct gcgcggaacg
121 tgcttctggt cacacagcac tatgccaaga tcagcgattt cggtctttcc aaagccctgc
181 gtgctgatga aaactactac aaggtaggag cgctcggtgc aagctcacag aacagggaga
241 ggaaacagct ctgtgcaggc tcacggagca ggctgagagc tcagtacagg ctcacagagc
301 agctgagggg acagcttcca tgcatagtta aggttgcagg ttataaagat atagaaagat
361 aaatgtgtgc tctctgtatt ttactatggt agaaatctca ctagtaacct tggaga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Tohyama, Y., and Yamamura, H. (2009) Protein Tyrosine Kinase, Syk: A Key Player in Phagocytic Cells. J Biochem. 145, 267-273.

  3. Sada, K., Takano, T., Yanagi, S., and Yamamura, H. (2001) Structure and Function of Syk Protein-Tyrosine Kinase. J Biochem. 130, 177-186.

  4. Mocsai, A., Ruland, J., and Tybulewicz, V. L. (2010) The SYK Tyrosine Kinase: A Crucial Player in Diverse Biological Functions. Nat Rev Immunol. 10, 387-402.

  5. Yanagi, S., Inatome, R., Takano, T., and Yamamura, H. (2001) Syk Expression and Novel Function in a Wide Variety of Tissues. Biochem Biophys Res Commun. 288, 495-498.

  6. Geahlen, R. L. (2009) Syk and pTyr'd: Signaling through the B Cell Antigen Receptor. Biochim Biophys Acta. 1793, 1115-1127.

  7. Rolli, V., Gallwitz, M., Wossning, T., Flemming, A., Schamel, W. W., Zurn, C., and Reth, M. (2002) Amplification of B Cell Antigen Receptor Signaling by a Syk/ITAM Positive Feedback Loop. Mol Cell. 10, 1057-1069.

  8. Guo, B., Su, T. T., and Rawlings, D. J. (2004) Protein Kinase C Family Functions in B-Cell Activation. Curr Opin Immunol. 16, 367-373.

  9. Palacios, E. H., and Weiss, A. (2007) Distinct Roles for Syk and ZAP-70 during Early Thymocyte Development. J Exp Med. 204, 1703-1715.

  10. Latour, S., Fournel, M., and Veillette, A. (1997) Regulation of T-Cell Antigen Receptor Signalling by Syk Tyrosine Protein Kinase. Mol Cell Biol. 17, 4434-4441.

  11. Mallick-Wood, C. A., Pao, W., Cheng, A. M., Lewis, J. M., Kulkarni, S., Bolen, J. B., Rowley, B., Tigelaar, R. E., Pawson, T., and Hayday, A. C. (1996) Disruption of Epithelial Gamma Delta T Cell Repertoires by Mutation of the Syk Tyrosine Kinase. Proc Natl Acad Sci U S A. 93, 9704-9709.

  12. Brumbaugh, K. M., Binstadt, B. A., Billadeau, D. D., Schoon, R. A., Dick, C. J., Ten, R. M., and Leibson, P. J. (1997) Functional Role for Syk Tyrosine Kinase in Natural Killer Cell-Mediated Natural Cytotoxicity. J Exp Med. 186, 1965-1974.

  13. Simon, M., Vanes, L., Geahlen, R. L., and Tybulewicz, V. L. (2005) Distinct Roles for the Linker Region Tyrosines of Syk in FcepsilonRI Signaling in Primary Mast Cells. J Biol Chem. 280, 4510-4517.

  14. Kiefer, F., Brumell, J., Al-Alawi, N., Latour, S., Cheng, A., Veillette, A., Grinstein, S., and Pawson, T. (1998) The Syk Protein Tyrosine Kinase is Essential for Fcgamma Receptor Signaling in Macrophages and Neutrophils. Mol Cell Biol. 18, 4209-4220.

  15. Crowley, M. T., Costello, P. S., Fitzer-Attas, C. J., Turner, M., Meng, F., Lowell, C., Tybulewicz, V. L., and DeFranco, A. L. (1997) A Critical Role for Syk in Signal Transduction and Phagocytosis Mediated by Fcgamma Receptors on Macrophages. J Exp Med. 186, 1027-1039.

  16. Wong, B. R., Grossbard, E. B., Payan, D. G., and Masuda, E. S. (2004) Targeting Syk as a Treatment for Allergic and Autoimmune Disorders. Expert Opin Investig Drugs. 13, 743-762.

  17. Pamuk, O. N., and Tsokos, G. C. (2010) Spleen Tyrosine Kinase Inhibition in the Treatment of Autoimmune, Allergic and Autoinflammatory Diseases. Arthritis Res Ther. 12, 222.

  18. Bajpai, M., Chopra, P., Dastidar, S. G., and Ray, A. (2008) Spleen Tyrosine Kinase: A Novel Target for Therapeutic Intervention of Rheumatoid Arthritis. Expert Opin Investig Drugs. 17, 641-659.

  19. Turner, M., Mee, P. J., Costello, P. S., Williams, O., Price, A. A., Duddy, L. P., Furlong, M. T., Geahlen, R. L., and Tybulewicz, V. L. (1995) Perinatal Lethality and Blocked B-Cell Development in Mice Lacking the Tyrosine Kinase Syk. Nature. 378, 298-302.

  20. Cheng, A. M., Rowley, B., Pao, W., Hayday, A., Bolen, J. B., and Pawson, T. (1995) Syk Tyrosine Kinase Required for Mouse Viability and B-Cell Development. Nature. 378, 303-306.

  21. Finney, B. A., Schweighoffer, E., Navarro-Nunez, L., Benezech, C., Barone, F., Hughes, C. E., Langan, S. A., Lowe, K. L., Pollitt, A. Y., Mourao-Sa, D., Sheardown, S., Nash, G. B., Smithers, N., Reis e Sousa, C., Tybulewicz, V. L., and Watson, S. P. (2012) CLEC-2 and Syk in the megakaryocytic/platelet Lineage are Essential for Development. Blood. 119, 1747-1756.

  22. Bohmer, R., Neuhaus, B., Buhren, S., Zhang, D., Stehling, M., Bock, B., and Kiefer, F. (2010) Regulation of Developmental Lymphangiogenesis by Syk(+) Leukocytes. Dev Cell. 18, 437-449.

  23. Kurosaki, T., Johnson, S. A., Pao, L., Sada, K., Yamamura, H., and Cambier, J. C. (1995) Role of the Syk Autophosphorylation Site and SH2 Domains in B Cell Antigen Receptor Signaling. J Exp Med. 182, 1815-1823.

  24. Zhang, J., Kimura, T., and Siraganian, R. P. (1998) Mutations in the Activation Loop Tyrosines of Protein Tyrosine Kinase Syk Abrogate Intracellular Signaling but Not Kinase Activity. J Immunol. 161, 4366-4374.

  25. Carsetti, L., Laurenti, L., Gobessi, S., Longo, P. G., Leone, G., and Efremov, D. G. (2009) Phosphorylation of the Activation Loop Tyrosines is Required for Sustained Syk Signaling and Growth Factor-Independent B-Cell Proliferation. Cell Signal. 21, 1187-1194.