Phenotypic Mutation 'beau' (pdf version)
List |< first << previous [record 30 of 511] next >> last >|
Allelebeau
Mutation Type missense
Chromosome1
Coordinate90,928,122 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Mlph
Gene Name melanophilin
Synonym(s) l1Rk3, l(1)-3Rk, D1Wsu84e, Slac-2a
Chromosomal Location 90,915,085-90,951,142 bp (+)
MGI Phenotype Homozygous targeted null mutants affect viability and body size, and result in abnormal lungs, kidneys, immune system, hematopoiesis, myelopoiesis, and anomalies in cerebellar foliation and neuronal cell layer development.
Accession Number

NCBI RefSeq: NM_053015; MGI:2176380

Mapped Yes 
Amino Acid Change Cysteine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027528] [ENSMUSP00000123314]
SMART Domains Protein: ENSMUSP00000027528
Gene: ENSMUSG00000026303
AA Change: C84R

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 2e-51 PFAM
low complexity region 147 160 N/A INTRINSIC
PDB:4KP3|F 170 208 1e-18 PDB
low complexity region 379 406 N/A INTRINSIC
Pfam:Rab_eff_C 437 501 1e-15 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000027528)
SMART Domains Protein: ENSMUSP00000123314
Gene: ENSMUSG00000026303
AA Change: C57R

DomainStartEndE-ValueType
Pfam:FYVE_2 10 98 1.3e-36 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000125149)
Phenotypic Category pigmentation, skin/coat/nails
Penetrance  
Alleles Listed at MGI

All mutations/alleles(7) : Chemically induced (ENU)(1) Chemically induced (other)(1) Gene trapped(1) Spontaneous(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mlph APN 1 90939390 missense probably damaging 1.00
IGL01779:Mlph APN 1 90942950 missense probably benign 0.00
IGL01952:Mlph APN 1 90933471 missense probably benign 0.00
Golem UTSW 1 unclassified
koala UTSW 1 90933301 splice acceptor site
R0652:Mlph UTSW 1 90942908 missense probably benign 0.18
R1374:Mlph UTSW 1 90941703 missense probably damaging 0.99
R1643:Mlph UTSW 1 90941734 missense probably damaging 1.00
R1853:Mlph UTSW 1 90945667 nonsense probably null
R1894:Mlph UTSW 1 90948579 splice acceptor site probably benign
R2395:Mlph UTSW 1 90933506 missense probably benign 0.10
R3875:Mlph UTSW 1 90928122 missense probably damaging 1.00
R4632:Mlph UTSW 1 90939386 missense probably damaging 0.99
R4720:Mlph UTSW 1 90941697 missense probably damaging 1.00
R4963:Mlph UTSW 1 90939390 missense probably damaging 1.00
R5588:Mlph UTSW 1 90931599 missense possibly damaging 0.94
R5901:Mlph UTSW 1 90939814 missense probably damaging 1.00
X0013:Mlph UTSW 1 90928154 missense possibly damaging 0.92
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038218-MU
Last Updated 12/07/2016 10:20 AM by Anne Murray
Record Created 09/02/2015 1:41 PM by Chad Daniel
Record Posted 09/22/2015
Phenotypic Description
Figure 1. The beau phenotype. The beau mouse (right) exhibits hypopigmentation compared to wild-type mice (left).

The beau phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R3875, some of which exhibited a dark gray coat (Figure 1). 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. Among these, only one affected a gene with known effects on pigmentation, Mlph. The mutation in Mlph was presumed to be causative because the beau hypopigmentation phenotype mimics other known alleles of Mlph (see MGI for a list of Mlph alleles as well as the record for koala). The Mlph mutation is a T to C transition at base pair 90,928,122 (v38) on chromosome 1, or base pair 13,101 in the GenBank genomic region NC_000067. The mutation corresponds to residue 428 in the mRNA sequence NM_053015 within exon 3 of 16 total exons.

 

413 CGACAGTGCCTAGAGTGCAGCCTCTTCGTCTGC

79  -R--Q--C--L--E--C--S--L--F--V--C-

 

The mutated nucleotide is indicated in red. The mutation results in a cysteine (C) to arginine (R) substitution at position 84 (C84R) in the melanophilin protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000) (1).

Protein Prediction

Figure 2. Domain structure of melanophilin. The Rab27-binding domain (R27BD) mediates binding to Rab27a and consists of two Slp homology domains (SHD) separated by a zinc finger motif. The middle domain or myosin-binding domain (MBD) contains two regions that bind to the globular tail domain (GTBD) and the exon F-encoding region (EFBD) of myosin Va. The actin-binding domain (ABD) binds to both F-actin and the microtubule plus end-binding protein EB1. Two coiled-coil domains (C1C2) are present in the ABD. The beau mutation results in a cysteine to arginine substitution at position 84 in the melanophilin protein. This image is interactive. Click on the image to view other mutations found in melanophilin. Click on the mutations for more specific information.

Melanophilin is a member of the Rab effector family that regulates the function of Rab proteins, GTPases that control multiple steps in the process of intracellular vesicular transport. The melanophilin N-terminus displays homology to the Rab effector domains of granuphilin-a and -b, synaptotagmin-like protein 3a (Slp3-a), and rabphilin-3A, proteins with putative roles in vesicle interactions with the cytoskeleton, vesicle docking, and fusion (2). The Rab binding domain (R27BD) of melanophilin is approximately 146 amino acids in length and mediates specific binding to GTP-bound Rab27a (3-5). The domain contains two zinc-binding CX2CX13,14CX2C (FYVE-type) motifs with highly conserved cysteines flanked by two Slp homology domains (SHD1 and SHD2; also known as Rab27 binding domains, R27BD-1 and R27BD-2) (2). The domain also contains a short aromatic acid-rich region (SLEWYY; residues 117-122 in melanophilin) at its C-terminus that mediates binding to Rab proteins (6). Following the N-terminal Rab27-binding domain, melanophilin contains a middle domain with two distinct regions that interact with the globular tail (amino acids 147-240) and melanocyte-specific exon F region (amino acids 330-406) of myosin Va (4;7-9). Finally, melanophilin contains a C-terminal F-actin (10;11) and endbinding protein 1 (EB1) interaction domain (12) (amino acids 401-590). The beau mutation results in a cysteine (C) to arginine (R) substitution at position 84 (C84R) within the zinc finger region of the R27BD.

 

Please see the record koala for information about Mlph.

Putative Mechanism

Melanins, the pigments for skin, hair and eyes, are synthesized in melanosomes.  Visible pigmentation in mammals requires the transfer of melanosomes from melanocytes where they are made, to keratinocytes. Melanophilin links melanosome-bound Rab27a to myosin Va by directly binding both proteins (3-5;7-9). The tripartite complex forms on melanosomes after activation of Rab27a to its GTP-bound form, and mediates the transfer of melanosomes from a microtubule-based kinesin motor to the actin-based motor myosin V (4;5;9). When this capture mechanism is lacking due to mutations in any of these three proteins, melanosomes redistribute along microtubules, and appear clustered in regions with high microtubule density, which is greatest near the central cytoplasm (13-15).  A mutation in human MLPH has been identified in a patient with Griscelli syndrome type 3 (16) (OMIM #609227), characterized by partial albinism of the skin and hair. The leaden (ln) phenotype, caused mutation of melanophilin (2), arose spontaneously in the C57BR strain and is characterized by a diluted coat color (17). In leaden melanocytes, melanosomes are synthesized normally, but cluster in the perinuclear region, resulting in uneven and impaired release of melanin (13;14;18). The phenotype of beau mice, which appears to be as severe as that of leaden mice, may suggest that Mlphbeau encodes a severely affected protein that exhibits perturbed binding to GTP-bound Rab27a.

Primers PCR Primer
beau(F):5'- TCACTGGTCGGTTGTAGAAAC -3'
beau(R):5'- CCAGAGAACCGATCTTCACG -3'

Sequencing Primer
beau_seq(F):5'- ATTTTTTCCCAAGGGGGC -3'
beau_seq(R):5'- GAGAACCGATCTTCACGACCCTG -3'
References
  17. Murray, J. M. (1933) "Leaden", a Recent Coat Color Mutation in the House Mouse. Am Naturalist. 67, 278-283.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsChad Daniel, Jamie Russel, Bruce Beutler
List |< first << previous [record 30 of 511] next >> last >|