Phenotypic Mutation 'beau'

• Allele: beau
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 90,855,844 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Mlph
• Gene Name: melanophilin
• Synonym(s): D1Wsu84e, Slac-2a
• Chromosomal Location: 90,842,807-90,878,864 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013] ; PHENOTYPE: Homozygous targeted null mutants affect viability and body size, and result in abnormal lungs, kidneys, immune system, hematopoiesis, myelopoiesis, and anomalies in cerebellar foliation and neuronal cell layer development. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000027528] [ENSMUSP00000123314]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000027528; Gene: ENSMUSG00000026303; AA Change: C84R

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	8	125	2e-51	PFAM
low complexity region	147	160	N/A	INTRINSIC
PDB:4KP3|F	170	208	1e-18	PDB
low complexity region	379	406	N/A	INTRINSIC
Pfam:Rab_eff_C	437	501	1e-15	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000027528)
• SMART Domains: Protein: ENSMUSP00000123314; Gene: ENSMUSG00000026303; AA Change: C57R

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	10	98	1.3e-36	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000125149)
• Meta Mutation Damage Score: 0.9688
• Is this an essential gene?: Probably nonessential (E-score: 0.095)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• MMRRC Submission: 038218-MU
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-09-02 1:41 PM by Chad Daniel
• Record Posted: 2015-09-22
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Chad Daniel, Jamie Russel, Bruce Beutler

Accession Number

NCBI RefSeq: NM_053015; MGI:2176380

Alleles Listed at MGI

All mutations/alleles(7) : Chemically induced (ENU)(1) Chemically induced (other)(1) Gene trapped(1) Spontaneous(1) Targeted(3)

Phenotypic Description

Figure 1. The beau phenotype. The beau mouse (right) exhibits hypopigmentation compared to wild-type mice (left).

The beau phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R3875, some of which exhibited a dark gray coat (Figure 1). 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. Among these, only one affected a gene with known effects on pigmentation, Mlph. The mutation in Mlph was presumed to be causative because the beau hypopigmentation phenotype mimics other known alleles of Mlph (see MGI for a list of Mlph alleles as well as the record for koala). The Mlph mutation is a T to C transition at base pair 90,928,122 (v38) on chromosome 1, or base pair 13,101 in the GenBank genomic region NC_000067. The mutation corresponds to residue 428 in the mRNA sequence NM_053015 within exon 3 of 16 total exons.

413 CGACAGTGCCTAGAGTGCAGCCTCTTCGTCTGC 79  -R--Q--C--L--E--C--S--L--F--V--C-

The mutated nucleotide is indicated in red. The mutation results in a cysteine (C) to arginine (R) substitution at position 84 (C84R) in the melanophilin protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000) (1).

Protein Prediction

Figure 2. Domain structure of melanophilin. The Rab27-binding domain (R27BD) mediates binding to Rab27a and consists of two Slp homology domains (SHD) separated by a zinc finger motif. The middle domain or myosin-binding domain (MBD) contains two regions that bind to the globular tail domain (GTBD) and the exon F-encoding region (EFBD) of myosin Va. The actin-binding domain (ABD) binds to both F-actin and the microtubule plus end-binding protein EB1. Two coiled-coil domains (C1C2) are present in the ABD. The beau mutation results in a cysteine to arginine substitution at position 84 in the melanophilin protein. This image is interactive. Click on the image to view other mutations found in melanophilin. Click on the mutations for more specific information.

Melanophilin is a member of the Rab effector family that regulates the function of Rab proteins, GTPases that control multiple steps in the process of intracellular vesicular transport. The melanophilin N-terminus displays homology to the Rab effector domains of granuphilin-a and -b, synaptotagmin-like protein 3a (Slp3-a), and rabphilin-3A, proteins with putative roles in vesicle interactions with the cytoskeleton, vesicle docking, and fusion (2). The Rab binding domain (R27BD) of melanophilin is approximately 146 amino acids in length and mediates specific binding to GTP-bound Rab27a (3-5). The domain contains two zinc-binding CX₂CX_13,14CX₂C (FYVE-type) motifs with highly conserved cysteines flanked by two Slp homology domains (SHD1 and SHD2; also known as Rab27 binding domains, R27BD-1 and R27BD-2) (2). The domain also contains a short aromatic acid-rich region (SLEWYY; residues 117-122 in melanophilin) at its C-terminus that mediates binding to Rab proteins (6). Following the N-terminal Rab27-binding domain, melanophilin contains a middle domain with two distinct regions that interact with the globular tail (amino acids 147-240) and melanocyte-specific exon F region (amino acids 330-406) of myosin Va (4;7-9). Finally, melanophilin contains a C-terminal F-actin (10;11) and endbinding protein 1 (EB1) interaction domain (12) (amino acids 401-590). The beau mutation results in a cysteine (C) to arginine (R) substitution at position 84 (C84R) within the zinc finger region of the R27BD.

Please see the record koala for information about Mlph.

Putative Mechanism

Melanins, the pigments for skin, hair and eyes, are synthesized in melanosomes.  Visible pigmentation in mammals requires the transfer of melanosomes from melanocytes where they are made, to keratinocytes. Melanophilin links melanosome-bound Rab27a to myosin Va by directly binding both proteins (3-5;7-9). The tripartite complex forms on melanosomes after activation of Rab27a to its GTP-bound form, and mediates the transfer of melanosomes from a microtubule-based kinesin motor to the actin-based motor myosin V (4;5;9). When this capture mechanism is lacking due to mutations in any of these three proteins, melanosomes redistribute along microtubules, and appear clustered in regions with high microtubule density, which is greatest near the central cytoplasm (13-15).  A mutation in human MLPH has been identified in a patient with Griscelli syndrome type 3 (16) (OMIM #609227), characterized by partial albinism of the skin and hair. The leaden (ln) phenotype, caused mutation of melanophilin (2), arose spontaneously in the C57BR strain and is characterized by a diluted coat color (17). In leaden melanocytes, melanosomes are synthesized normally, but cluster in the perinuclear region, resulting in uneven and impaired release of melanin (13;14;18). The phenotype of beau mice, which appears to be as severe as that of leaden mice, may suggest that Mlph^beau encodes a severely affected protein that exhibits perturbed binding to GTP-bound Rab27a.

Primers

PCR Primer
beau_pcr_F: TCACTGGTCGGTTGTAGAAAC
beau_pcr_R: CCAGAGAACCGATCTTCACG

Sequencing Primer
beau_seq_F: ATTTTTTCCCAAGGGGGC
beau_seq_R: GAGAACCGATCTTCACGACCCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 423 nucleotides is amplified (chromosome 1, + strand):

1   tcactggtcg gttgtagaaa caaactgtct aatgtatttc ttatcccatt ttttcccaag
61  ggggctgaag ggcaaaatac aaaaggagag ctccaagagg gagctgctgt cggacacagc
121 ccatctgaat gagactcact gtgcccgctg cctgcagccc taccggctgc tcctgaacag
181 cagacgacag tgcctagagt gcagcctctt cgtctgcaaa agctgcagcc acgcccaccc
241 agaagagcag ggctggctct gcgacccctg ccacctggcc aggtgaggag cggggaggca
301 gagcccgtcc ctaatggtgt cttagcctgg tgtgtccctt tgggggactg gctggggggg
361 cggggaggca ctgcctcagg ctgcacccat ctccccgcag ggtcgtgaag atcggttctc
421 tgg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Matesic, L. E., Yip, R., Reuss, A. E., Swing, D. A., O'Sullivan, T. N., Fletcher, C. F., Copeland, N. G., and Jenkins, N. A. (2001) Mutations in Mlph, Encoding a Member of the Rab Effector Family, Cause the Melanosome Transport Defects Observed in Leaden Mice. Proc Natl Acad Sci U S A. 98, 10238-10243.

  3. Kuroda, T. S., Fukuda, M., Ariga, H., and Mikoshiba, K. (2002) The Slp Homology Domain of Synaptotagmin-Like Proteins 1-4 and Slac2 Functions as a Novel Rab27A Binding Domain. J Biol Chem. 277, 9212-9218.

  4. Strom, M., Hume, A. N., Tarafder, A. K., Barkagianni, E., and Seabra, M. C. (2002) A Family of Rab27-Binding Proteins. Melanophilin Links Rab27a and Myosin Va Function in Melanosome Transport. J Biol Chem. 277, 25423-25430.

  5. Fukuda, M., and Itoh, T. (2004) Slac2-a/melanophilin Contains Multiple PEST-Like Sequences that are Highly Sensitive to Proteolysis. J Biol Chem. 279, 22314-22321.

  6. Ostermeier, C., and Brunger, A. T. (1999) Structural Basis of Rab Effector Specificity: Crystal Structure of the Small G Protein Rab3A Complexed with the Effector Domain of Rabphilin-3A. Cell. 96, 363-374.

  7. Fukuda, M., and Kuroda, T. S. (2004) Missense Mutations in the Globular Tail of Myosin-Va in Dilute Mice Partially Impair Binding of Slac2-a/melanophilin. J Cell Sci. 117, 583-591.

  8. Wu, X. S., Rao, K., Zhang, H., Wang, F., Sellers, J. R., Matesic, L. E., Copeland, N. G., Jenkins, N. A., and Hammer, J. A.,3rd. (2002) Identification of an Organelle Receptor for Myosin-Va. Nat Cell Biol. 4, 271-278.

  9. Wu, X., Wang, F., Rao, K., Sellers, J. R., and Hammer, J. A.,III. (2002) Rab27a is an Essential Component of Melanosome Receptor for Myosin Va. Mol Biol Cell. 13, 1735-1749.

  10. Fukuda, M., and Kuroda, T. S. (2002) Slac2-c (Synaptotagmin-Like Protein Homologue Lacking C2 Domains-c), a Novel Linker Protein that Interacts with Rab27, Myosin Va/VIIa, and Actin. J Biol Chem. 277, 43096-43103.

  11. Kuroda, T. S., Ariga, H., and Fukuda, M. (2003) The Actin-Binding Domain of Slac2-a/melanophilin is Required for Melanosome Distribution in Melanocytes. Mol Cell Biol. 23, 5245-5255.

  12. Wu, X. S., Tsan, G. L., and Hammer, J. A.,III. (2005) Melanophilin and Myosin Va Track the Microtubule Plus End on EB1. J Cell Biol. 171, 201-207.

  13. Wu, X., Bowers, B., Rao, K., Wei, Q., and Hammer, J. A.,III. (1998) Visualization of Melanosome Dynamics within Wild-Type and Dilute Melanocytes Suggests a Paradigm for Myosin V Function in Vivo. J Cell Biol. 143, 1899-1918.

  14. Provance, D. W.,Jr., Wei, M., Ipe, V., and Mercer, J. A. (1996) Cultured Melanocytes from Dilute Mutant Mice Exhibit Dendritic Morphology and Altered Melanosome Distribution. Proc Natl Acad Sci U S A. 93, 14554-14558.

  15. Koyama, Y. I., and Takeuchi, T. (1981) Ultrastructural Observations on Melanosome Aggregation in Genetically Defective Melanocytes of the Mouse. Anat Rec. 201, 599-611.

  16. Menasche, G., Ho, C. H., Sanal, O., Feldmann, J., Tezcan, I., Ersoy, F., Houdusse, A., Fischer, A., and de Saint, B. G. (2003) Griscelli Syndrome Restricted to Hypopigmentation Results from a Melanophilin Defect (GS3) Or a MYO5A F-Exon Deletion (GS1). J Clin Invest. 112, 450-456.

  17. Murray, J. M. (1933) "Leaden", a Recent Coat Color Mutation in the House Mouse. Am Naturalist. 67, 278-283.

  18. Hume, A. N., Collinson, L. M., Rapak, A., Gomes, A. Q., Hopkins, C. R., and Seabra, M. C. (2001) Rab27a Regulates the Peripheral Distribution of Melanosomes in Melanocytes. J Cell Biol. 152, 795-808.