Phenotypic Mutation 'gnostic_gospel'

• Allele: gnostic_gospel
• Mutation Type: missense
• Chromosome: 18
• Coordinate: 4,333,965 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Map3k8
• Gene Name: mitogen-activated protein kinase kinase kinase 8
• Synonym(s): Tpl2, Cot, Cot/Tpl2, Tpl-2, c-COT
• Chromosomal Location: 4,331,325-4,352,978 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011] ; PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000025078] [ENSMUSP00000133469]
• AlphaFold: Q07174
• SMART Domains: Protein: ENSMUSP00000025078; Gene: ENSMUSG00000024235; AA Change: R376C

Domain	Start	End	E-Value	Type
Pfam:Pkinase	137	388	1.1e-47	PFAM
Pfam:Pkinase_Tyr	139	386	4.6e-26	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000025078)
• SMART Domains: Protein: ENSMUSP00000133469; Gene: ENSMUSG00000024235

Domain	Start	End	E-Value	Type
SCOP:d1phk__	146	169	2e-4	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9621
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• MMRRC Submission: 038217-MU
• Last Updated: 2017-09-11 5:26 PM by Diantha La Vine
• Record Created: 2015-09-04 9:50 PM by Bruce Beutler
• Record Posted: 2015-09-22
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Lei Sun, Zhao Zhang, Hexin Shi, Jeff SoRelle, Takuma Misawa, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_007746; MGI:1346878

Alleles Listed at MGI

All Mutations and Alleles 14: Chemically induced (ENU) 3; Targeted 11

Phenotypic Description

Figure 1. Gnostic_gospel mice exhibited decreased TNFα secretion in response to TLR9 ligand, CpGODN. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Gnostic_gospel mice exhibited decreased TNFα secretion in response to TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Gnostic_gospel mice exhibited decreased TNFα secretion in response to TLR1/2 ligand, Pam 3 CSK 4 . TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Gnostic_gospel mice exhibited decreased TNFα secretion in response to TLR3 ligand, poly(I:C). TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gnostic_gospel phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3625, some of which showed reduced TNFα (see the record for PanR1) secretion in response to the Toll-like receptor ligands CpG oligodeoxynucleotide (TLR9; Figure 1), lipopolysaccharide (TLR4; Figure 2), Pam₃CSK₄ (TLR1/2; Figure 3), and poly(I:C) (TLR3; Figure 4).

Nature of Mutation

Figure 5. Linkage mapping of reduced TNFα secretion after LPS stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R3625. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Map3k8:  a C to T transition at base pair 4,333,965 (v38) on chromosome 18, or base pair 19,517 in the NC_000084 GenBank genomic region. The strongest association was found with a recessive model of linkage to the normalized level of TNFα secretion to LPS, wherein five variant homozygotes departed phenotypically from eight homozygous reference mice and 17 heterozygous mice with a P value of 1.067 x 10^-5 (Figure 5).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The mutation corresponds to residue 1,250 in the mRNA sequence NM_008713 within exon 7 of 8 total exons.

1235 AGGAACCCCAACCACCGCCCCAAAGCAGCAGAC 371  -R--N--P--N--H--R--P--K--A--A--D-

The mutated nucleotide is indicated in red.  The mutation results in an arginine (R) to cysteine (C) substitution at position 376 (R376C) in the TPL2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000) (1).

Protein Prediction

Figure 6. Domain structure of TPL2 protein. The TPL2 protein contains an N-terminal domain, a kinase domain, and a C-terminal region. A PEST sequence was identified between residues 415 and 438. There is a conserved ATP-binding lysine (K167), and phosphorylation of T290 is required for activation. The gnostic_gospel mutation (red asterisk) is an arginine (R) to cysteine (C) substitution at position 376. The image is interactive; click to see other Map3k8 mutations.

Map3k8 encodes TPL2 (tumor progression locus 2)/COT (cancer Osaka thryoid)/MAP3K8, a serine/threonine kinase member of the mitogen-activated protein kinase kinase kinase (MAP3K) family of proteins. Full-length TPL2 contains three domains: the N-terminal domain (amino acids 1-132), the kinase domain (amino acids 133-388), and a C-terminal region (Figure 6). The N-terminal domain may have a role in regulating protein stability (2).  The kinase domain of TPL2 shows sequence homology to the kinase domains of other MAP3 kinases (2-4). The C-terminus of TPL2 appears both to inhibit TPL2 kinase activity (5-7), and to target the protein for degradation (7;8).  The gnostic_gospel mutation results in an arginine (R) to cysteine (C) substitution at position 376 (R376C) within the kinase domain of TPL2.

Please see the record Sluggish for information about Map3k8.

Putative Mechanism

TPL2 activates the MEK/ERK pathway downstream of most TLRs. Upon TLR stimulation, both p105 and TPL2 are phosphorylated by the IKK complex, resulting in degradation of p105 and the release and activation of TPL2 (9). Phosphorylation of TPL2 by the IKK complex occurs at T290, and is necessary for both the dissociation of TPL2 from p105, as well as kinase activity (10-12). Activated TPL2 phosphorylates MEK1/2 (MAP kinase 1 and 2), which then activates ERK1/2 (13-15). The gnostic_gospel phenotype is similar to that of Sluggish (16), juicy and Mapk38-deficient mice in that TNFα production by gnostic_gospel macrophages is abnormal in response to TLR agonists. In Mapk38-deficient macrophages, the levels of TNF-α are normal, but the transport of TNF-α mRNA to the cytoplasm in response to LPS is defective, suggesting that TPL2 regulates TNF-α mRNA transport, but not stability (14).

Primers

PCR Primer
gnostic_gospel_pcr_F: CATCAGAGCTTTGCTGTAGACAG
gnostic_gospel_pcr_R: AATAGGTCTCTCCCCTAGCC

Sequencing Primer
gnostic_gospel_seq_F: TGGCTCCACACCCACAGG
gnostic_gospel_seq_R: TAGCCTTTCCTGCAGAAGATATACC

Genotyping

NOTE: These primers have not been validated.

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R36250037_Map3k8_PCR_F: 5’- CATCAGAGCTTTGCTGTAGACAG-3’

R36250037_Map3k8_PCR_R: 5’- AATAGGTCTCTCCCCTAGCC-3’

Sequencing Primers

R36250037_Map3k8_SEQ_F: 5’- TGGCTCCACACCCACAGG-3’
 

R36250037_Map3k8_SEQ_R: 5’- TAGCCTTTCCTGCAGAAGATATACC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 414 nucleotides is amplified (NCBI RefSeq: NC_000084, chromosome 18):

catcagagct ttgctgtaga cagcaggagg gaggccagtg gctccacacc cacaggcata       

cacccacaca cccagcatgg tgtcctacca gcaatgttct caggaagttg tagttccttc      

ctgctcagca gcctcttccg ttcaaagagg gcagagtcca gactctgaca tcgtggctgg      

tcctctcttg ggggattcag ggcttcatgt ttcagtaggt ctgctgcttt ggggcggtgg      

ttggggttcc tctccagggc agcttctatc agctccctca tgcctggact gcagtcacca      

gcgatgtctt ccaggggagg tgcctgcttg tggatctgcc aacaaaccag ctctgtaagc      

atggatggag tagaggtata tcttctgcag gaaaggctag gggagagacc tatt

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated G is shown in red text (Chr. + strand, G>A).

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Aoki, M., Hamada, F., Sugimoto, T., Sumida, S., Akiyama, T., and Toyoshima, K. (1993) The human cot proto-oncogene encodes two protein serine/threonine kinases with different transforming activities by alternative initiation of translation, J Biol. Chem. 268, 22723-22732.

  3. Ohara, R., Miyoshi, J., Aoki, M., and Toyoshima, K. (1993) The murine cot proto-oncogene: genome structure and tissue-specific expression, Jpn. J Cancer Res. 84, 518-525.

  4. Patriotis, C., Makris, A., Bear, S. E., and Tsichlis, P. N. (1993) Tumor progression locus 2 (Tpl-2) encodes a protein kinase involved in the progression of rodent T-cell lymphomas and in T-cell activation, Proc. Natl. Acad. Sci. U. S. A 90, 2251-2255.

  5. Ceci, J. D., Patriotis, C. P., Tsatsanis, C., Makris, A. M., Kovatch, R., Swing, D. A., Jenkins, N. A., Tsichlis, P. N., and Copeland, N. G. (1997) Tpl-2 is an oncogenic kinase that is activated by carboxy-terminal truncation, Genes Dev. 11, 688-700.

  6. Robinson, M. J., Beinke, S., Kouroumalis, A., Tsichlis, P. N., and Ley, S. C. (2007) Phosphorylation of TPL-2 on serine 400 is essential for lipopolysaccharide activation of extracellular signal-regulated kinase in macrophages, Mol. Cell Biol. 27, 7355-7364.

  7. Gandara, M. L., Lopez, P., Hernando, R., Castano, J. G., and Alemany, S. (2003) The COOH-terminal domain of wild-type Cot regulates its stability and kinase specific activity, Mol. Cell Biol. 23, 7377-7390.

  8. Wu, B. and Wilmouth, R. C. (2008) Proteomics analysis of immunoprecipitated proteins associated with the oncogenic kinase cot, Mol. Cells 25, 43-49.

  9. Waterfield, M., Jin, W., Reiley, W., Zhang, M., and Sun, S. C. (2004) IkappaB Kinase is an Essential Component of the Tpl2 Signaling Pathway. Mol Cell Biol. 24, 6040-6048.

  10. Luciano, B. S., Hsu, S., Channavajhala, P. L., Lin, L. L., and Cuozzo, J. W. (2004) Phosphorylation of Threonine 290 in the Activation Loop of Tpl2/Cot is Necessary but Not Sufficient for Kinase Activity. J Biol Chem. 279, 52117-52123.

  11. Cho, J., and Tsichlis, P. N. (2005) Phosphorylation at Thr-290 Regulates Tpl2 Binding to NF-kappaB1/p105 and Tpl2 Activation and Degradation by Lipopolysaccharide. Proc Natl Acad Sci U S A. 102, 2350-2355.

  12. Cho, J., Melnick, M., Solidakis, G. P., and Tsichlis, P. N. (2005) Tpl2 (Tumor Progression Locus 2) Phosphorylation at Thr290 is Induced by Lipopolysaccharide Via an Ikappa-B Kinase-Beta-Dependent Pathway and is Required for Tpl2 Activation by External Signals. J Biol Chem. 280, 20442-20448..

  13. Waterfield, M. R., Zhang, M., Norman, L. P., and Sun, S. C. (2003) NF-kappaB1/p105 Regulates Lipopolysaccharide-Stimulated MAP Kinase Signaling by Governing the Stability and Function of the Tpl2 Kinase. Mol Cell. 11, 685-694.

  14. Dumitru, C. D., Ceci, J. D., Tsatsanis, C., Kontoyiannis, D., Stamatakis, K., Lin, J. H., Patriotis, C., Jenkins, N. A., Copeland, N. G., Kollias, G., and Tsichlis, P. N. (2000) TNF-Alpha Induction by LPS is Regulated Posttranscriptionally Via a Tpl2/ERK-Dependent Pathway. Cell. 103, 1071-1083.

  15. Beinke, S., Deka, J., Lang, V., Belich, M. P., Walker, P. A., Howell, S., Smerdon, S. J., Gamblin, S. J., and Ley, S. C. (2003) NF-kappaB1 p105 Negatively Regulates TPL-2 MEK Kinase Activity. Mol Cell Biol. 23, 4739-4752.

  16. Xiao, N., Eidenschenk, C., Krebs, P., Brandl, K., Blasius, A. L., Xia, Y., Khovananth, K., Smart, N. G., and Beutler, B. (2009) The Tpl2 Mutation Sluggish Impairs Type I IFN Production and Increases Susceptibility to Group B Streptococcal Disease. J Immunol. 183, 7975-7983.