Phenotypic Mutation 'imp'

• Allele: imp
• Mutation Type: nonsense
• Chromosome: 12
• Coordinate: 41,160,846 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Immp2l
• Gene Name: IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)
• Synonym(s): IMP2
• Chromosomal Location: 41,074,089-42,002,371 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in processing the signal peptide sequences used to direct mitochondrial proteins to the mitochondria. The encoded protein resides in the mitochondria and is one of the necessary proteins for the catalytic activity of the mitochondrial inner membrane peptidase (IMP) complex. Two variants that encode the same protein have been described for this gene. [provided by RefSeq, Sep 2011] ; PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced fertility, abnormal cellular respiration, and decreased body weight. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000079055] [ENSMUSP00000118779] [ENSMUSP00000116441]
• AlphaFold: Q8BPT6
• SMART Domains: Protein: ENSMUSP00000079055; Gene: ENSMUSG00000056899; AA Change: L48*

Domain	Start	End	E-Value	Type
SCOP:d1b12a_	33	77	3e-6	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000118779; Gene: ENSMUSG00000056899; AA Change: L48*

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	115	7.7e-11	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000116441; Gene: ENSMUSG00000056899; AA Change: L48*

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S24	38	114	6.4e-11	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9754
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-09-04 9:56 PM by Bruce Beutler
• Record Posted: 2016-09-27
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Zhe Chen and Bruce Beutler

Accession Number

NCBI RefSeq: NM_053122; MGI:2135611

Alleles Listed at MGI

All Mutations and Alleles(63) : Gene trapped(61) Targeted(1) Transgenic (1)

Phenotypic Description

Figure 1. Imp mice exhibited reduced body weights compared to wild-type littermates. Scaled body weights data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The imp phenotype was identified among G3 mice of the pedigree R3404, some of which showed reduced body weights compared to their wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the diminished body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R3404. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. The body weight phenotype was linked to a mutation in Immp2l: a T to A transversion at base pair 41,110,847 (v38) on chromosome 12, or base pair 86,758 in the GenBank genomic region NC_000078 encoding Immp2l. Linkage was found with a recessive model of inheritance (P = 2.276 x 10^-8), wherein nine homozygous variant mice departed phenotypically from 18 heterozygous mice and five homozygous reference mice (Figure 2).

The mutation corresponds to residue 274 in the NM_053122 mRNA sequence in exon 4 of 7 total exons. 

258 TCAATGCAGCCTTCTTTGAATCCTGGAGGAAGC 43  -S--M--Q--P--S--L--N--P--G--G--S-

The mutated nucleotide is indicated in red.  The mutation results in substitution of leucine (L) 48 to a premature stop codon (L48*) in the coded protein.

Protein Prediction

Figure 3. Protein domain organization of mouse IMMP2L. IMMP2L has a putative transmembrane domain (TM) at amino acids 19-37 (Uniprot) and a peptidase S24/S26A domain at aimino acids 38-114. The imp mutation results in substitution of leucine (L) 48 to a premature stop codon (L48*).

Immp2l encodes the 175-amino acid inner mitochondrial membrane peptidase 2-like (IMMP2L). IMMP2L is proposed to have a single transmembrane domain at amino acids 19-37 (UniProt) and a peptidase S24/26A domain at amino acids 38-114 (Figure 3). Peptidase S24/26A domains are found in members of the S24 (LexA family, clan SF), S26A (signal peptidase I), and S26B (signalase) serine peptidase families. The peptidase S24/S26A domain is comprised for several coiled beta-sheets, and contains an SH3-like barrel structure. UniProt predicts that active sites in mouse IMMP2L are at amino acids 43 and 91.

Ensembl lists three putative protein-coding mouse Immp2l transcripts. Two of the transcripts encode a 175-amino acid protein, while the third 239 base pair cDNA transcript encodes a 79-amino acid protein product.

The Immp2l mutation in imp results in substitution of leucine (L) 48 to a premature stop codon. Amino acid 48 is within the peptidase domain.

Expression/Localization

Immp2l is ubiquitously expressed (1). The IMMP2L protein localizes to the inner mitochondrial membrane.

Background

Mitochondria promote cellular energy production by converting sugar, fat, and proteins into ATP via oxidative phosphorylation. Mitochondria also regulate apoptosis, intracellular calcium homeostasis, and production of reactive oxygen species.

Mitochondrial inner membrane proteins need bipartite signal sequences to properly localize. The first signal is a mitochondrial targeting signal sequence, and the second is a mitochondrial inner membrane targeting signal sequence. The mitochondrial targeting signal sequence guides the precursor proteins to the mitochondrial matrix, and then is cleaved in the matrix by a mitochondrial processing peptidase. The mitochondrial inner membrane targeting signal sequence guides the intermediate proteins to the inner membrane and is cleaved by mitochondrial inner membrane peptidases (IMP). The IMPs cleave the intermembrane space-sorting signals from precursor or intermediate polypeptides after they reach the intermembrane space (or the inner membrane).

In yeast, the IMP complex is comprised of a heterodimer of inner membrane peptidase 1 (Imp1p) and Imp2p, which exhibit nonoverlapping substrate specificity, and a third subunit, Som1p, which does not have peptidase activity. In yeast, Imp2p is necessary for the stability and function of Imp1p (2). Cytochrome c1 is the substrate for yeast Imp2p (2); mitochondrial glycerol phosphate dehydrogenase 2 (Gut2p), cytochrome b2, cytochrome c oxidase subunit II (CoxII), and NADH-cytochrome b5 reductase are substrates for yeast Imp1p (3;4). IMMP1L and IMMP2L are the mammalian homologs of Imp1p and Imp2p, respectively. The relationship between the mammalian homologs is unknown.

Figure 4. IMMP2L cleaves GPD2 and Cyc1, essential members of the electron transport chain (ETC). Electrons enter the ETC on the inner mitochondrial membrane (IMM). Complex I to IV are membrane-bound protein complexes in the ETC that facilitate the passage of electrons with the aid of electron carriers, such as ubiquinone (Q), cytochromes, and iron-sulfur proteins. The transfer of the electrons yields a highly exergonic reaction that is used to pump protons out of the mitochondrial matrix, which generates the membrane potential across the IMM and proton-motive force in the IMM. The proton-motive force drives the synthesis of ATP. Cytochrome c accepts electrons from Complex III and diffuses to Complex IV (cytochrome oxidase), where it donates the electrons to O 2 , converting O 2 to H 2 O. The glycerol phosphate shutle is a secondary mechanism for the transport of electrons from cytosolic NADH to mitochondrial carriers of the oxidative phosphorylation pathway. GPD2 is involved in the glycerol phosphate shuttle. FAD + is a substrate of GDP2. The glycerol phosphate shuttle provides a continual conversion of the glycolytic intermediate, DHAP and glycerol-3-phosphate with the concomitant transfer of the electrons from reduced cytosolic NADH to mitochondrial oxidized FAD + . The electrons from mitochondrial FADH 2 feed into the oxidative phosphorylation pathway at coenzyme Q.

Cytochrome c1 (CYC1) is a known substrate of mammalian IMMP2L. Cytochrome C1 is a component of the mitochondrial respiratory chain complex III (Figure 4). Complex III and complex I are the major sites of superoxide generation in mitochondria (5). Ubiquinol from complex I (NADH:ubiquinone oxidoreductase) and complex II are oxidized by complex III to reduce cytochrome c; CYC1 is the subunit that transfers the electron to cytochrome c (6). CYC1 has to be processed through two steps in order to function properly in mitochondrial electron transport. IMMP2L mediates the second processing step for CYC1 maturation.

Glycerol-3-phosphate dehydrogenase 2 (GPD2) is another substrate of IMMP2L. GPD2 catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate. GPD2 and GPD1 form the glycerol phosphate shuttle, which uses the interconversion of glycerol-3-phosphate and dihydroxyacetone phosphate to transfer reducing equivalents into the mitochondria, subsequently resulting in the reoxidation of NADH formed during glycolysis.

DIABLO/Smac, a mitochondrial protein that mediates the release and activation of caspases during apoptosis, is processed by a mitochondrial protease and then released into the cytosol. The IMP complex is proposed to process the precursor form of DIABLO/Smac, which has an N-terminal presequence that must be cleaved to generate a mature form of the protein (7). DIABLO is recognized and translocated through the mitochondrial outer membrane via the translocase in the outer mitochondrial membrane (TOM) complex and in the intermembrane space is transferred to the translocase in the inner mitochondrial membrane (TIM23) complex.

Immp2l mutant mice expressing a truncated Immp2l containing the first six exons (Immp2l^{Tg(Tyr)979Ove}) exhibited impaired gametogenesis and erectile dysfunction (8). The mutant females were infertile with defects in folliculogenesis and ovulation. Mutant males were subfertile, with erectile dysfunction and age-related defects in spermatogenesis (8;9). Mitochondria from the Immp2l^{Tg(Tyr)979Ove} mice exhibited hyperpolarization, increased superoxide ion generation, and increased levels of ATP. The Immp2l^{Tg(Tyr)979Ove} mice developed to adulthood, but were less able to gain weight, weighing approximately 10% less than normal mice; the lower body weight was not significant after the age of 4 to 5 months. The mice exhibited 30% reduced food intake (8;10). When wild-type and mutant mice were fed equivalent amounts of food, the mice exhibited similar body weights and body compositions up to the age of 20 months (10). Bladder dysfunction was observed in both male and female Immp2l^{Tg(Tyr)979Ove} mice (11). The Immp2l^{Tg(Tyr)979Ove} mice exhibited increased oxidative stress in several organs including the brain and kidney (12). The Immp2l^{Tg(Tyr)979Ove} mice also developed ataxia, wasting, sarcopenia, loss of subcutaneous fat, and kyphosis with age (12). Immp2l-deficient (Immp2l^+/-) mice exhibited increased cerebral infarct volume and oxidative DNA damage after middle cerebral artery occlusion (13). The increased brain damage in the Immp2l^+/- mice was linked to elevated reactive oxygen species production and the suppression of mitochondrial respiration control ratio, and electron transport chain complexes II+III, and IV activities in early reperfusion stages after transient focal ischemia.

Mutation of human IMMP2L has been linked to increased susceptibility to Gilles de la Tourette syndrome (14-17). Gilles de la Tourette syndrome is a neurological disorder characterized by multiple involuntary motor and vocal tics (17). In a Danish cohort, seven out of 188 Tourette syndrome patients had intragenic IMMP2L deletions (14). Four of the seven deletions were within intron 3 and affected a shorter IMMP2L mRNA with two alternative 5’-exons (14). Both mRNAs (long and short) were expressed in the brain, with high expression in the cerebellum and hippocampus (14). Partial deletions or duplications of IMMP2L is proposed to be a risk factor for other neurological diseases in addition to Tourette syndrome, including autistic spectrum disorders and attention-deficit hyperactivity disorders (18).

Putative Mechanism

The imp mice exhibit reduced body weights similar to the Immp2l^{Tg(Tyr)979Ove} mice. Food intake was not monitored in the imp mice. Deficient IMMP2L function in the imp mice could also be affecting the processing of the IMMP2L substrates Cyc1 and GPD2 (8). Gpd2-deficient mice exhibit reduced body weights (19;20), indicating that loss of IMMP2L-associated GDP2 processing may be leading to the reduced body weights observed in Immp2l mutant mice. However, one study found that the IMMP2L substrate proteins exhibited normal expression and compartmentalization in the Immp2l mutant mice (1). The expression of CYC1 and GPD2 were not analyzed in the imp mice. In total, the phenotype of the imp mice indicates loss of IMMP2L^imp function.

Primers

PCR Primer
imp_pcr_F: GAGGAATCCTAGTTAGCCTGTC
imp_pcr_R: TGCTACATGAAGCCTAACAGTTG

Sequencing Primer
imp_seq_F: TCCTAGTTAGCCTGTCTGAAAAC
imp_seq_R: CCATAACTGGACAGATAGTATCAGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 423 nucleotides is amplified (chromosome 12, + strand):

1   gaggaatcct agttagcctg tctgaaaact catttgttct tgctttaaaa ttgtacagta
61  gtaggatttt ttttattgaa ttgttctcaa gctatgaagt acactgcatc ataaagactg
121 aaaaatatta caagtgataa atgtatctct tcttattttg tagccttctt tgaatcctgg
181 aggaagccag tcctcagatg tggtactttt gaaccactgg aaagtgagaa attttgaagt
241 acagcgtggt gacattgtgt cattggtgta agtaactcag taacttactg tatttgtttt
301 tgtgtttttc tggacttagc tgataattta ctgctgatac tatctgtcca gttatggtat
361 taatgagcgt atcttaaata taatcagtat tgagatatag caactgttag gcttcatgta
421 gca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Bharadwaj, M. S., Zhou, Y., Molina, A. J., Criswell, T., and Lu, B. (2014) Examination of Bioenergetic Function in the Inner Mitochondrial Membrane Peptidase 2-Like (Immp2l) Mutant Mice. Redox Biol. 2C, 1008-1015.

  2. Nunnari, J., Fox, T. D., and Walter, P. (1993) A Mitochondrial Protease with Two Catalytic Subunits of Nonoverlapping Specificities. Science. 262, 1997-2004.

  3. Behrens, M., Michaelis, G., and Pratje, E. (1991) Mitochondrial Inner Membrane Protease 1 of Saccharomyces Cerevisiae shows Sequence Similarity to the Escherichia Coli Leader Peptidase. Mol Gen Genet. 228, 167-176.

  4. Esser, K., Jan, P. S., Pratje, E., and Michaelis, G. (2004) The Mitochondrial IMP Peptidase of Yeast: Functional Analysis of Domains and Identification of Gut2 as a New Natural Substrate. Mol Genet Genomics. 271, 616-626.

  5. Chen, Q., Vazquez, E. J., Moghaddas, S., Hoppel, C. L., and Lesnefsky, E. J. (2003) Production of Reactive Oxygen Species by Mitochondria: Central Role of Complex III. J Biol Chem. 278, 36027-36031.

  6. Hunte, C., Palsdottir, H., and Trumpower, B. L. (2003) Protonmotive Pathways and Mechanisms in the Cytochrome bc1 Complex. FEBS Lett. 545, 39-46.

  7. Burri, L., Strahm, Y., Hawkins, C. J., Gentle, I. E., Puryer, M. A., Verhagen, A., Callus, B., Vaux, D., and Lithgow, T. (2005) Mature DIABLO/Smac is Produced by the IMP Protease Complex on the Mitochondrial Inner Membrane. Mol Biol Cell. 16, 2926-2933.

  8. Lu, B., Poirier, C., Gaspar, T., Gratzke, C., Harrison, W., Busija, D., Matzuk, M. M., Andersson, K. E., Overbeek, P. A., and Bishop, C. E. (2008) A Mutation in the Inner Mitochondrial Membrane Peptidase 2-Like Gene (Immp2l) Affects Mitochondrial Function and Impairs Fertility in Mice. Biol Reprod. 78, 601-610.

  9. George, S. K., Jiao, Y., Bishop, C. E., and Lu, B. (2012) Oxidative Stress is Involved in Age-Dependent Spermatogenic Damage of Immp2l Mutant Mice. Free Radic Biol Med. 52, 2223-2233.

  10. Han, C., Zhao, Q., and Lu, B. (2013) The Role of Nitric Oxide Signaling in Food Intake; Insights from the Inner Mitochondrial Membrane Peptidase 2 Mutant Mice. Redox Biol. 1, 498-507.

  11. Soler, R., Fullhase, C., Lu, B., Bishop, C. E., and Andersson, K. E. (2010) Bladder Dysfunction in a New Mutant Mouse Model with Increased Superoxide--Lack of Nitric Oxide? J Urol. 183, 780-785.

  12. George, S. K., Jiao, Y., Bishop, C. E., and Lu, B. (2011) Mitochondrial Peptidase IMMP2L Mutation Causes Early Onset of Age-Associated Disorders and Impairs Adult Stem Cell Self-Renewal. Aging Cell. 10, 584-594.

  13. Ma, Y., Mehta, S. L., Lu, B., and Li, P. A. (2011) Deficiency in the Inner Mitochondrial Membrane Peptidase 2-Like (Immp21) Gene Increases Ischemic Brain Damage and Impairs Mitochondrial Function. Neurobiol Dis. 44, 270-276.

  14. Bertelsen, B., Melchior, L., Jensen, L. R., Groth, C., Glenthoj, B., Rizzo, R., Debes, N. M., Skov, L., Brondum-Nielsen, K., Paschou, P., Silahtaroglu, A., and Tumer, Z. (2014) Intragenic Deletions Affecting Two Alternative Transcripts of the IMMP2L Gene in Patients with Tourette Syndrome. Eur J Hum Genet. 22, 1283-1289.

  15. Patel, C., Cooper-Charles, L., McMullan, D. J., Walker, J. M., Davison, V., and Morton, J. (2011) Translocation Breakpoint at 7q31 Associated with Tics: Further Evidence for IMMP2L as a Candidate Gene for Tourette Syndrome. Eur J Hum Genet. 19, 634-639.

  16. Petek, E., Schwarzbraun, T., Noor, A., Patel, M., Nakabayashi, K., Choufani, S., Windpassinger, C., Stamenkovic, M., Robertson, M. M., Aschauer, H. N., Gurling, H. M., Kroisel, P. M., Wagner, K., Scherer, S. W., and Vincent, J. B. (2007) Molecular and Genomic Studies of IMMP2L and Mutation Screening in Autism and Tourette Syndrome. Mol Genet Genomics. 277, 71-81.

  17. Petek, E., Windpassinger, C., Vincent, J. B., Cheung, J., Boright, A. P., Scherer, S. W., Kroisel, P. M., and Wagner, K. (2001) Disruption of a Novel Gene (IMMP2L) by a Breakpoint in 7q31 Associated with Tourette Syndrome. Am J Hum Genet. 68, 848-858.

  18. Gimelli, S., Capra, V., Di Rocco, M., Leoni, M., Mirabelli-Badenier, M., Schiaffino, M. C., Fiorio, P., Cuoco, C., Gimelli, G., and Tassano, E. (2014) Interstitial 7q31.1 Copy Number Variations Disrupting IMMP2L Gene are Associated with a Wide Spectrum of Neurodevelopmental Disorders. Mol Cytogenet. 7, 54-014-0054-y. eCollection 2014.

  19. Brown, L. J., Koza, R. A., Everett, C., Reitman, M. L., Marshall, L., Fahien, L. A., Kozak, L. P., and MacDonald, M. J. (2002) Normal Thyroid Thermogenesis but Reduced Viability and Adiposity in Mice Lacking the Mitochondrial Glycerol Phosphate Dehydrogenase. J Biol Chem. 277, 32892-32898.

  20. Eto, K., Tsubamoto, Y., Terauchi, Y., Sugiyama, T., Kishimoto, T., Takahashi, N., Yamauchi, N., Kubota, N., Murayama, S., Aizawa, T., Akanuma, Y., Aizawa, S., Kasai, H., Yazaki, Y., and Kadowaki, T. (1999) Role of NADH Shuttle System in Glucose-Induced Activation of Mitochondrial Metabolism and Insulin Secretion. Science. 283, 981-985.