Phenotypic Mutation 'pococurante' (pdf version)
Allelepococurante
Mutation Type missense
Chromosome9
Coordinate119,338,114 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Myd88
Gene Name myeloid differentiation primary response gene 88
Chromosomal Location 119,335,934-119,341,411 bp (-)
MGI Phenotype Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology.
Accession Number

NCBI RefSeq: NM_010851; MGI: 108005

Mapped Yes 
Amino Acid Change Isoleucine changed to Asparagine
Institutional SourceBeutler Lab
Ref Sequences
I179N in Ensembl: ENSMUSP00000035092 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
DEATH 19 109 7.17e-15 SMART
TIR 160 296 3.39e-25 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.67; Specificity: 0.97)
(Using Ensembl: ENSMUSP00000035092)
Phenotypic Category decrease in response to injected CpG DNA, DSS: sensitive day 7, immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages, TLR signaling defect: type I IFN production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(3) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Myd88 APN 9 119337352 splice site noncoding transcript
Dani_alves UTSW 9 119337823 missense possibly damaging 0.69
lackadaisical UTSW 9 119338692 missense probably damaging 1.00
Myd88rev1 UTSW 9 119337394 missense probably damaging 0.99
R1695:Myd88 UTSW 9 119337842 nonsense probably null
R1878:Myd88 UTSW 9 119338620 missense probably benign 0.00
R2413:Myd88 UTSW 9 119337418 missense probably benign 0.06
R3417:Myd88 UTSW 9 119337490 missense possibly damaging 0.90
R3836:Myd88 UTSW 9 119338193 missense probably benign
R3892:Myd88 UTSW 9 119337816 missense possibly damaging 0.93
R3917:Myd88 UTSW 9 119341398 start gained unknown
R4003:Myd88 UTSW 9 119338610 missense noncoding transcript
R4081:Myd88 UTSW 9 119339987 missense unknown
R4634:Myd88 UTSW 9 119338109 nonsense probably null
R4637:Myd88 UTSW 9 119338109 nonsense probably null
R5091:Myd88 UTSW 9 119337823 missense possibly damaging 0.69
R5426:Myd88 UTSW 9 119339750 missense noncoding transcript
R5604:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
R5604_K:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
R5604_Q:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Embryos, Sperm, gDNA
MMRRC Submission 010475-UCD
Last Updated 06/14/2017 10:38 AM by Katherine Timer
Record Created unknown
Record Posted 11/30/2007
Phenotypic Description
Figure 1. TNF responses of peritoneal macrophages from pococurante (Poc) mice treated with various TLR ligands (A-H). All TLR signaling is abolished except for signaling through TLR3 (F), TLR2/6 (G) and (H). Macrophages from Myd88 knockout mice are used as controls. Values represent mean ± SEM (n=6 mice or more). (I) Macrophages from WT or Poc mice were pretreated with IFN-γ (10 units/ml) then treated with TLR ligands and assayed for type I IFN. Pococurante macrophages do not respond to CpG (TLR9 ligand) or resiquimod (TLR7 ligand), but show normal type I IFN in response to LPS and poly I:C (due to signaling through the MyD88-independent pathway). Similar results were observed in three independent experiments. Figure reproduced from reference (1).
The pococurante phenotype was identified in a screen for ENU-induced mutants with altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1). Peritoneal macrophages from pococurante mice fail to produce tumor necrosis factor (TNF)-α in response to Pam3CSK4 (a triacyl lipopeptide, TLR2/1 ligand), lipoteichoic acid (TLR2/6 ligand), resiquimod (TLR7 ligand) and unmethylated CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand). Pococurante macrophages produce no TNF-α when stimulated with low concentrations of lipopolysaccharide (LPS, TLR4 ligand), and markedly reduced amounts of TNF-α in response to high concentrations of LPS. In contrast, signaling via TLR3, stimulated by poly I:C, is normal. Pam2CSK4 and MALP-2, which are believed to signal via TLR2/6 complexes and/or TLR2 homodimers, also elicit a near normal response (Figure 1). 
 
Phosphorylation of JNK, the MAP kinase ERK, and IκB is eliminated or drastically reduced in pococurante macrophages upon either Pam3CSK4 or resiquimod stimulation, but retained in response to MALP-2 and Pam2CSK4, in agreement with the TNF-α assay results. Thus, the pococurante phenotype resembles the MyD88-/- phenotype in TLR ligand sensitivity, except that some TLR2 signaling is retained; moreover, pococurante discriminates between two types of TLR2 ligands.
 
Unlike MyD88-/- mice, pococurante mice do not develop spontaneous bacterial infections. When tested for susceptibility to specific bacterial infections, pococurante mice are able to contain an intradermal Streptococcus pyogenes infection that MyD88-/- mice fail to control, albeit at a slower rate than wild type. MyD88-deficient mice and pococurante homozygotes are equally susceptible to Listeria monocytogenes and to mouse cytomegalovirus (MCMV) infections (MCMV Susceptibility and Resistance Screen). Pococurante homozygotes are susceptible to dextran sodium sulfate (DSS)-induced colitis, exhibiting progressive weight loss beginning around nine days after continuous administration of 1% DSS in the drinking water, when wild type mice have not lost any weight (DSS-induced Colitis Screen).

 

Nature of Mutation
The Myd88 gene on Chromosome 9 of pococurante mice was sequenced, and a T to A transversion identified in exon 3 (of 6 total exons) at position 617 of the Myd88 transcript. The pococurante locus was confirmed to be allelic with Myd88.
 
601 TTTGTGCAGGAGATGATCCGGCAACTAGAACAG
174 -F--V--Q--E--M--I--R--Q--L--E--Q-
 
The mutated nucleotide is indicated in red lettering, and results in a conversion of isoleucine to asparagine at residue 179 of the MYD88 protein.
Protein Prediction
MyD88 is a 296 amino acid protein adapter that relays signals from the IL-1 and IL-18 receptors and from most TLRs. It is a modular protein containing an N-terminal death domain encoded by the first exon (aa 1-109), which shares similarity with regions of the p55 tumor necrosis factor receptor type I and Fas antigen receptor (Figure 2) (2;3). The death domain was first identified in proteins involved in cell death induction, but it is now known also to be a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins (4).
 
Figure 2. MyD88 domain structure and 3D TIR domain. A, MyD88 is a 296 amino acid protein adapter. It contains an N-terminal death domain (DD) that acts as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins. The C-terminal portion of MyD88 contains a Toll/IL-1 receptor (TIR) domain, a conserved region which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling. Between the death domain and TIR domain is an “intermediate domain” that may be required for differential activation of distinct NF-κB- versus JNK-dependent transcriptional programs. The pococurante mutation replaces isoleucine with asparagine at position 179. B, The 3D structure shows the six α-helices and five β-strands of the TIR domain. 3D structure was created using UCSF Chimera package (2Z5V). This image is interactive. Click on the image to view other mutations found in MyD88 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.
Following the MyD88 death domain is an “intermediate domain” encoded by exon 2 (5). Alternative splicing of Myd88 results in a variant that lacks the intermediate domain (MyD88s), which is expressed only in the spleen and brain (5). When overexpressed in HEK293 cells, MyD88s is able to bind IRAK, but does not activate NF-κB (a hallmark of MyD88 signaling, discussed in Background), reportedly because MyD88s is unable to induce IRAK phosphorylation (5). The MyD88 intermediate domain has been suggested to provide for differential activation of distinct (NF-κB- versus JNK-dependent) transcriptional programs (6).
 
The C-terminal portion of MyD88 (exons 3-5) contains a Toll/IL-1 receptor (TIR) domain (2;3), a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling (9;10). TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (named for the α-helix and β-strand they connect; e.g. AA connects βA with αA). The crystal structures of the TLR1 and TLR2 TIR domains reveal that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (11) (see languid). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4 (see lps3), which has been reported to abolish MyD88 binding to a constitutively active TLR4 mutant (12), and LPS-induced signaling in mice (13). Nevertheless, amino acid identity between any two TIR domains is generally only about 25% (14), and significant conformational differences exist between the TIR domains of TLR1, TLR2 and IL-1RAPL (IL-1R accessory protein-like) (11;14). Thus, specific sequence elements unique to each TIR domain-containing protein likely confer particular binding partner recognition.
 
The pococurante mutation replaces isoleucine with asparagine at position 179, which exists near the center of the αA helix of the MyD88 TIR domain. The mechanism by which it may cause the mutant phenotype is discussed below (Putative Mechanism).
Expression/Localization
MyD88 transcript is detected in most tissues including heart, brain, spleen, lung, liver, muscle, kidney and testis, and in T, B and myeloid cell lines (2;15). MyD88 is localized in distinct condensed particles scattered throughout the cytoplasm (16-18), reportedly in organelles yet to be identified (18). Using TIR domain-swapped and truncation mutants of MyD88, this subcellular localization was attributed to the death domain and/or intermediate domain, since mutants lacking portions of either domain localized diffusely throughout the cytoplasm (18). Interestingly, truncation mutants that localized diffusely in the cytoplasm failed to activate an NF-κB luciferase reporter construct when transfected into HEK293 cells (18).
Background
TLRs are transmembrane receptors that sense molecules of microbial origin and trigger host cell responses. The twelve mouse TLRs and ten human TLRs recognize a wide range of structurally distinct molecules, and all signal through only four adapter proteins known to date: MyD88, Tirap (Mal), TICAM-1 (TRIF) and TICAM-2 (TRAM) (19). TLR signaling through these adapters initiates a cascade of signaling events involving various kinases, adapters and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7.
 
MyD88 was first characterized as a differentiation marker induced by IL-6 treatment of myeloleukemic cells as they lose the ability to proliferate and come to resemble mature macrophages (20). Several years later, MyD88 was shown to function in signaling from the IL-1 receptor (IL-1R) (4;21;22), and from TLRs (Figure 3)(23). Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it functions as an adapter to recruit IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6 (4;23). The ensuing signaling pathway has been extensively studied, and culminates in the activation of NF-κB-dependent transcription [reviewed in (19;24)]. Briefly, IRAK-1 and TRAF6 dissociate from the receptor complex, and freed TRAF6 interacts with TAK1, activating it to phosphorylate the IκB kinase (IKK) complex. The IKK complex phosphorylates IκB, targeting it for degradation and relieving its inhibition of NF-κB which translocates to the nucleus and activates expression of target genes including IL-6, IL-1, TNF, IL-12p40 and type I interferon, cytokines required for the inflammatory response. Recent work demonstrates that TLR signaling through MyD88 also activates interferon regulatory factor 5 (IRF5), leading to induction of inflammatory cytokines but not type I interferon production (25). MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus (25).
 
Figure 3. MyD88 signaling pathways. MyD88 is a protein adapter that relays signals from the IL-1 and IL-8 receptors (not shown) and from most TLRs. Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it recruits IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6. The signaling pathway culminates in the activation of NF-κB-dependent transcription. MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus. MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly. This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1.
MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly in order to stimulate IFN-α production (16;26). This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1 (27).
 
The function of MyD88 in IL-1R and TLR signaling has been confirmed using MyD88-deficient mice. Myd88-/- mice display no response to IL-1, including T cell proliferation or cytokine induction, and fail to activate NF-κB (28). In TLR signaling, MyD88 is known to serve all the TLRs except for TLR3. Thus, TLR2/1, TLR2/6, TLR5, TLR7 and TLR9 signaling leading to activation of NF-κB is abolished in MyD88-deficient mice. In the case of TLR4 signaling, NF-κB activation still occurs in Myd88-/- mice, but with delayed kinetics compared to wild type (29). The adapter TRIF is responsible for this second, late wave of NF-κB activity (30;31), but it cannot fully compensate for lack of MyD88 in the production of inflammatory cytokines nor in the induction of LPS-induced shock responses nor in resistance to several bacterial infections (1;29). MyD88-deficient mice are highly susceptible to infections with Staphylococcus aureus (32), Toxoplasma gondii (33), Listeria monocytogenes (1;34), Leishmania major (35) and mouse cytomegalovirus (36).
Putative Mechanism
Figure 4. Proposed TIR domain interactions based on docking studies. A, Face-to-face interaction model mediating receptor:adaptor binding. TLR2 is shown in blue, and MyD88 is shown in yellow. Individual amino acids and motifs are indicated by arrows in colors corresponding to the color of each protein. The critical P residue of each BB loop is shown in red, and the critical V or I residue of the Poc site is shown in green. B, Back-to-back interaction model mediating TIR domain oligomerization. Blue and yellow ribbons represent TIR domains of two different MyD88 proteins or two different TLR2 molecules after ligand stimulation. The interaction is mediated by the C-terminal α-helices (αE) in an antiparallel fashion. Figure reproduced from reference (1).
Molecular modeling indicates two principal modes of receptor:adapter TIR domain interaction: face-to face, involving BB loop and pococurante site interactions, and back-to-back, involving αE helix interactions (1). The classical Lps mutation (P712H) in the BB loop of the TIR domain of murine TLR4 abolishes LPS signaling (13). Based on comparisons with the structure of the TLR2 TIR domain (11), both P712 in TLR4 and I179 in MyD88 appear to protrude from clusters of hydrophobic amino acids. When the BB loop mutation is engrafted onto TLR2, TLR2BB is able to activate NF-κB reporter gene transcription (36). To test the importance of I179 (the “Poc” site) in the context of receptors, the corresponding mutation was made in TLR2, TLR4 or TLR9. TLR2Poc is able to activate NF-κB, and respond to MALP-2, but not lipoteichoic acid or Pam3CSK4. In contrast, TLR4Poc and TLR9Poc are unable to activate NF-κB. Mutation of either site on MyD88 still allows MALP-2-dependent NF-κB activation, but mutation of both sites abrogates this ability. MyD88poc can bind TLR2. These findings suggest that in the case of TLR2/6 signaling, either the BB loop site or the Poc site is sufficient for the receptor:adapter interaction (when one of the proteins is wild type). Thus, the BB loop and Poc site may serve the same molecular function in the TLR2/6:MyD88 interaction. In the case of TLR4 or TLR9, disruption of either the BB-loop site or the Poc site is sufficient to abolish interaction (1).
 
Mutation of two conserved amino acids within the αE helix of either TLR2 or MyD88 prevents ligand-induced NF-κB activation (1). However, MyD88 containing the αE helix mutations is still able to bind wild type TLR2 or TLR4 in immunoprecipitation experiments. These data support the conclusion that the αE helix of TIR domains is required for homotypic oligomerization of TIR domains (both in the case of the receptors and MyD88). Homotypic oligomerization is required for propagation of the signal from the receptor (i.e., recruitment of an adapter subunit) and from the adapter to more distal elements of the pathway. This conclusion is supported by similar mutagenesis studies of MyD88 in IL-1 receptor interactions (10).
 
On the basis of these observations as well as molecular docking studies, a model for receptor:adapter TIR domain interactions has been proposed, in which both the Poc site and BB loop contribute to the interface between the receptor and adapter, and the αE helix contributes to receptor oligomerization and to adapter oligomerization (1) (Figure 2).
Primers Primers cannot be located by automatic search.
Genotyping
Pococurante genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Poco(F): 5’-AACCGGGATTTCATCTGGGAGGAAG -3’
Poco(R): 5’-TCGTCAGAAACAACCACCACCATGC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:20
4) 68°C             1:00
5) repeat steps (2-4) 35X
6) 68°C             5:00
7) 4°C               ∞
 
Primers for sequencing
Poco_seq(F): 5’- AGACTCCAGGTTGGGCTCCTTC -3’
Poco_seq(R): 5’- CCAGCTAGCAGGACAGTCCTTG -3’
 
The following sequence of 544 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Cd14) is amplified:
 
1685     aaccgg gatttcatct gggaggaagt tatctgttca ctggtagaga gggcatgtat
1741 atgacattgc tttgatatgg atacaggccc aggttccctt gatggaagac tccaggttgg
1801 gctccttcca gccttctgca gaggctgatt gattcccttg tcccctgtcc tcaggacaaa
1861 cgccggaact tttcgatgcc tttatctgct actgccccaa cgatatcgag tttgtgcagg
1921 agatgatccg gcaactagaa cagacagact atcggcttaa gttgtgtgtg tccgaccgtg
1981 acgtcctgcc gggcacctgt gtctggtcca ttgccagcga gctaattgag aaaaggttgg
2041 ttaaacatct aagagggtag gtgggtgaat gcatgaaacc cagaggtcca gatgcaagga
2101 ctgtcctgct agctgggctc tgtcccgcct gggtaatgta gtccttcctg accccatcct
2161 ctgaaggaag tcaccgcagt gccactctcc ctcaggtgtc gccgcatggt ggtggttgtt
2221 tctgacga
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
   
Science Writers Alyson Mack, Eva Marie Y. Moresco
Illustrators Diantha La Vine, Katherine Timer
AuthorsZhengfan Jiang, Katharina Brandl, Bruce Beutler
Edit History
05/31/2011 2:02 PM (current)
05/31/2011 2:01 PM
05/31/2011 1:52 PM
05/31/2011 1:46 PM
05/31/2011 1:45 PM
05/31/2011 1:18 PM
05/27/2011 10:47 AM
05/27/2011 10:31 AM
04/25/2011 11:52 AM
07/23/2010 12:08 PM
07/13/2010 10:10 AM
07/13/2010 10:04 AM
07/13/2010 10:04 AM
05/25/2010 1:15 PM
05/25/2010 1:07 PM
05/25/2010 11:34 AM
05/25/2010 11:34 AM
05/25/2010 11:30 AM
05/25/2010 11:29 AM
05/25/2010 11:24 AM
02/03/2010 4:50 PM