Phenotypic Mutation 'itxaro'

• Allele: itxaro
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 46,229,044 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Itk
• Gene Name: IL2 inducible T cell kinase
• Synonym(s): Tcsk, Tsk, Emt
• Chromosomal Location: 46,215,977-46,280,342 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020664] [ENSMUSP00000104860]
• AlphaFold: Q03526
• SMART Domains: Protein: ENSMUSP00000020664; Gene: ENSMUSG00000020395; AA Change: F373L

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART
SH2	237	328	9.44e-29	SMART
TyrKc	362	611	3.28e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000020664)
• SMART Domains: Protein: ENSMUSP00000104860; Gene: ENSMUSG00000020395; AA Change: F379L

Domain	Start	End	E-Value	Type
PH	5	119	3.94e-12	SMART
BTK	119	155	1.1e-21	SMART
SH3	180	236	5.87e-14	SMART
SH2	243	334	9.44e-29	SMART
TyrKc	368	617	3.28e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000109237)
• Meta Mutation Damage Score: 0.9285
• Is this an essential gene?: Probably nonessential (E-score: 0.088)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: gDNA
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-09-13 9:25 PM by Tao Yue
• Record Posted: 2016-10-13
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Katherine Timer
• Authors: Tao Yue, Bruce Beutler, Takuma Misawa, Ming Zeng, Xue Zhong

Accession Number

NCBI RefSeq: NM_001281965 (variant 1), NM_010583 (variant 2), NM_001281966 (variant 3), NM_001281967 (variant 4), NM_001281968 (variant 5); MGI:96621

Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (other)(1) Targeted(8)

Phenotypic Description

Figure 1. Itxaro mice exhibit reduced frequencies of peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Itxaro mice exhibit reduced frequencies of peripheral CD4 T cells in CD3 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Itxaro mice exhibit reduced frequencies of peripheral naive CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Itxaro mice exhibit increased frequencies of peripheral central memory CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Itxaro mice exhibit increased frequencies of peripheral effector memory CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Itxaro mice exhibit increased expression of CD44 on peripheral blood CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Itxaro mice exhibit increased expression of CD44 on peripheral blood CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Itxaro mice exhibit increased expression of IgE in the serum. ELISA was utilized to determine amount of IgE. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The itxaro phenotype was identified in two out of 22 G3 mice from pedigree R2419.  They exhibited a reduced frequency of CD4 T cells in the blood (Figure 1 & 2).  Although the frequency of CD8 T cells was normal, within that population naïve CD8 T cells were reduced (Figure 3) and central memory CD8 T cells were increased (Figure 4).  Effector memory CD4 T cell frequency was also elevated (Figure 5).  Both CD4 and CD8 T cells showed elevated CD44 expression (Figure 6 & 7, respectively). Mice with the itxaro phenotype also had increased levels of IgE in the serum (Figure 8).

Nature of Mutation

Figure 9. Linkage mapping of the increased level of serum IgE using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 64 mutations (X-axis) identified in the G1 male of pedigree R2419. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire from pedigree R2419 identified 64 mutations.  All aspects of the itxaro phenotype were linked by continuous variable mapping to a mutation in Itk: an A to G transition at base pair 46,338,217 (GRCm38) on chromosome 11, or base pair 51,299 in the GenBank genomic region NC_000077 encoding Itk.  The strongest linkage (P = 5.939 x 10^-11) was found with a recessive model of inheritance to the level of IgE in the serum, wherein 2 homozygous variant mice departed phenotypically from 14 heterozygous and 6 wild type mice (Figure 9).

The mutation corresponds to residue 1,240 in the mRNA sequence NM_001281965, within 12 of 17 exons.

1225 ATTGGCAGCGGGCAGTTTGGGCTGGTGCATCTC 374  -I--G--S--G--Q--F--G--L--V--H--L-

The mutated nucleotide is indicated in red.  The mutation results in a phenylalanine to leucine substitution at position 379 (F379L) in the ITK protein (isoform 1).

Protein Prediction

Figure 10. Protein domain organization of mouse ITK. The location of the itxaro mutation (F379L) is indicated. Abbreviations: PH, pleckstrin homology domain; Tec, Tec homology domain. See the text for more details.

ITK is one of five members of the Tec family of tyrosine kinases, which includes ITK, Btk, Tec, Bmx, and Rlk (also called Txk).  ITK is 625 and 620 amino acids in length in mice and humans, respectively.  The mouse and human proteins are 93% identical in sequence.

ITK is a 72 kD protein with similarity to Csk and the Src and Abl family tyrosine kinases in the organization of its SH3-SH2-kinase domain cassette (Figure 10) (1-5).  However, ITK lacks the N-terminal myristoylation consensus sequence and the C-terminal negative regulatory tyrosine residue present in Src kinases, indicating a distinct regulatory mechanism.  Activation of ITK involves phosphorylation of tyrosine 511 in the kinase domain activation loop by Lck, followed by autophosphorylation of tyrosine 180 in the SH3 domain (6;7).  This autophosphorylation event is positively regulated by the SH2 domain and by the 17-amino acid linker between the SH2 and kinase domains (8;9). In contrast to the inhibitory role of the SH2-kinase domain linker in Src family kinase activation, the function of the ITK linker appears to be stabilization of the active conformation of ITK.  In particular, tryptophan 355 in the SH2-kinase domain linker is necessary for the kinase activity of ITK; this residue is conserved in Src where it plays a negative regulatory role (8).  Once activated, ITK phosphorylates and activates phospholipase C γ1 (PLCγ1); interaction between the two proteins is phosphotyrosine-independent and is mediated by the SH2 domain of PLCγ1 and the kinase domain of ITK (10).

The N-terminus of ITK contains a pleckstrin homology (PH) domain that binds to the membrane phospholipid phosphatidylinositol 3,4,5-trisphosphate (PIP₃), thereby recruiting ITK to the plasma membrane to interact with the activated T cell receptor (11-13).  Within the PH domain, three aromatic amino acids (FYF), conserved in Tec kinases but absent from PH domains of other proteins, are necessary for ITK binding to PIP3, consequent membrane recruitment, and ITK auto- and substrate phosphorylation (14).  The FYF motif is not required for ITK interaction with signaling partners SLP-76 and LAT; complex formation between ITK and LAT requires the SH2 domain of ITK (15).  The PH domain of ITK also self-associates to mediate multimerization of the protein (13); intermolecular interactions between the SH3 and SH2 domains of different ITK molecules also contribute to multimerization (16;17).  Intermolecular association of ITK precludes binding of SLP-76.

The ITK N-terminus also contains a Tec homology domain consisting of a Btk homology (BH) motif that binds to zinc and a proline-rich region that binds to SH3 domains (18).  The BH motif is reportedly necessary for the interaction between ITK and Gα13, an α subunit of heterotrimeric G proteins (19).  Following TCR activation, ITK and Gα13 interact to activate the transcription factor serum response factor (SRF) (19;20).

Figure 11. Crystal structure of the phosphorylated human ITK catalytic domain. The approximate location of residue 379 is indicated. Figure was generated by UCSF Chimera and is based on PDB:1SM2. Images is interactive; click to rotate.

The three dimensional structure of full length ITK has not been solved, but several crystal structures of the isolated kinase domain have been reported (Figure 11; (21-26)).  These include the structures of the ITK kinase domain in complex with small molecule inhibitors of ITK, in development as potential therapeutics for inflammatory diseases such as asthma.  The structure of the ITK kinase domain is typical of protein kinases, and includes globular N-terminal and C-terminal lobes connected by a flexible hinge (21).  The hinge forms part of the catalytic active site, which is located in the cleft between the two lobes.  The N-terminal lobe consists of five β strands and one α helix, while the larger C-terminal lobe consists of seven α helices and two small β strands.  Interestingly, the similar conformations of staurosporine-bound ITK and staurosporine-bound phosphorylated ITK revealed that phosphorylation of tyrosine 511 in the kinase domain activation loop fulfills a different function than in Src kinases, where this phosphorylation event promotes movement of the activation loop away from the catalytic cleft.

The glycine rich ATP-binding loop (GxGxxG) is a well-conserved motif in protein kinases and in ITK it also forms part of the ATP-binding pocket (GSGQFG).  The itxaro mutation affects the phenylalanine preceding the third glycine residue of the motif.

Expression/Localization

ITK is expressed mainly in T lymphocytes (1;3), and also in NK cells (2), mast cells, and myeloid cells (5).  Its expression is five- to ten-fold higher in thymocytes than in peripheral T cells (3).  During mouse development, ITK expression is detected prenatally in the thymus, where its levels increase through the neonatal period into adulthood (3).  In mice, ITK mRNA expression was increased in T cells in response to stimulation with IL-2; this upregulation was not observed in human T cells (1;2).  ITK is localized in the cytoplasm.

Background

Figure 12. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class II and I, respectively, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR, and CD4/8 engagement of MHC, initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca²⁺) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP₂) to inositol-1,4,5-trisphosphate (IP₃) and DAG resulting in Ca²⁺-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB (NF-κB) activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors. This image is interactive; click to view alleles associated with the TCR pathway and click on the alleles to connect to the respective Mutagenetix entry.

ITK in TCR signaling

T cells become activated when the T cell receptor (TCR) engages a peptide antigen in complex with an MHC molecule on the surface of a target or antigen-presenting cell (Figure 12).  Ligand binding to the TCR initiates signaling that culminates in the intracellular mobilization of calcium ions (Ca²⁺), actin cytoskeletal reorganization, and activation of transcription factors that regulate the production of cytokines.  ITK is a component of the proximal TCR signaling complex where it is required for activation of phospholipase C γ1 (PLCγ1) and subsequent Ca²⁺ mobilization, as described briefly below [see (27) for an extensive review]. 

The TCR is composed of two peptide chains (TCRα/β for most T cells), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ; see tumormouse) and a ζ homodimer (see allia) (28).  In addition to co-engagement of CD4 or CD8 coreceptors (see alfalfa), signaling by the TCR complex depends on the phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMS) present in the CD3 and ζ chains.  Following ligand binding, the Src family kinases Lck (see iconoclast ) and Fyn are recruited by either CD4 or CD8 to the receptor complex and phosphorylate ITAMs in the cytoplasmic tails of CD3 proteins.  These ITAMs then recruit Zap-70 (ζ-chain-associated protein of 70 kDa; see murdock) and Syk (spleen tyrosine kinase), which trans- and auto-phosphorylate, forming binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins including LAT (linker for activation of T cells) and SLP-76 (SH2 domain-containing leukocyte protein of 76 kDa).  Zap-70 and Syk phosphorylate LAT and SLP-76.  Recruitment to phosphorylated tyrosines in LAT and SLP-76 nucleates a large protein complex that includes PLCγ1, PI3K, GRB2, Gads, Vav1, Nck, and ITK.  In particular, ITK is brought to the plasma membrane by interactions between the ITK PH domain and accumulated PIP₃ produced by PI3K.  The SH3 and SH2 domains of ITK then interact with SLP-76 and LAT, following which ITK is phosphorylated on Y511 by Lck and autophosphorylated on Y180 (6;7;29).

Once activated, ITK phosphorylates PLCγ1 on Y783 and Y775 (7;30-33), activating PLCγ1 to hydrolyze phosphatidylinositol 4,5 bisphosphate (PIP₂) to produce inositol triphosphate (IP₃) and diacylglycerol (DAG) (28).  While DAG activates the Ras and PKCθ pathways leading to Erk and NF-κB activation, IP₃ regulates cytosolic Ca²⁺ influx leading to NFAT translocation to the nucleus.  Interestingly, ITK preferentially promotes the influx of extracellular Ca²⁺ as opposed to intracellular Ca²⁺ from ER stores (34).  In T cells deficient in ITK, PLCγ1 activation is impaired resulting in reduced Ca²⁺ influx to the cytoplasm, and consequently reduced activation of Erk and NFAT; these defects cause decreased IL-2 production and T cell proliferation in response to TCR activation (30;34;35).  In addition to ITK, the Tec kinases RLK and TEC are also expressed in T cells.  Because both ITK and RLK are capable of phosphorylating PLCγ1, their combined deficiency results in more severe defects of TCR signaling than observed in Itk^-/- T cells (30).

ITK in T cell effector function

By regulating PLCγ1 in response to TCR activation, ITK is important for several aspects of T cell differentiation and effector function.  First, ITK is necessary for Th2 cytokine production by CD4 T cells.  Mice lacking ITK failed to mount Th2 responses to Leishmania major, Nippostrongylus brasiliensis, and Schistosoma mansoni infections, with their CD4 T cells producing reduced IL-4, IL-5, and IL-10 after infection (36;37).  In vitro T cell stimulation under Th2 conditions induced commitment to the Th2 lineage by Itk^-/- cells, but upon restimulation Itk^-/- T cells failed to support transcriptional enhancement of Th2 cytokine genes (38).  This finding was interpreted to mean that ITK is required for the Th2 effector T cell response as opposed to Th2 differentiation.  Regardless, reduced NFAT activation was detected in Itk^-/- T cells stimulated with TCR and CD28 antibodies and likely underlies impaired IL-4 production (36).  Notably, Itk^-/- mice developed significantly less lung inflammation in a model of allergic asthma, which is characterized by Th2-mediated inflammation (39-41).  Th2 responses of Itk^-/- mice could be restored by overexpression of RLK, indicating at least partial redundancy of ITK and RLK function (42;43).  In contrast to the impaired Th2 responses to parasitic infections, Th1 responses to intracellular protozoans were largely intact in Itk^-/- mice (36;42).  In fact, Itk^-/- CD4 T cells differentiate into IFNγ-producing cells even when stimulated under conditions that normally induce Th2 differentiation (42).  However, a recent study showed that a small molecule inhibitor of ITK and RLK could block Th1 differentiation and IFNγ production in vitro and in vivo (44).  A possible role for ITK in CD4 Th cell migration has also been suggested (39;45;46).

In addition to impaired Th2 cytokine responses, CD4 T cell differentiation to the Th17 lineage is also defective in ITK-deficient mice (47).  Itk^-/- T cells produced reduced IL-17A expression in response to Th17 polarizing signals in vitro.  Interestingly, although the Il17a and IL17f genes are co-regulated transcriptionally (48), production of IL17F by Itk^-/- cells was relatively normal.  Defective IL-17A production was attributed to reduced Ca²⁺ influx and NFAT activation, which were found to be specifically required for Il17a but not Il17f transcription (47).  The development of Th17 cells, which are proinflammatory, is balanced against that of T regulatory (Treg) cells, which are immune suppressive.  ITK deficiency was found to positively regulate Treg cell differentiation (49).  In the absence of ITK, T cells exhibited increased responses to IL-2, a cytokine that promotes Treg cell differentiation but inhibits Th17 cell differentiation.  Thus, ITK regulates the balance between Th17 and Treg cell populations.

In CD8 T cells, ITK deficiency causes defective PLCγ1, p38, and ERK activation, and a reduction in Ca²⁺ influx in response to stimulation in vitro (50).  Although viral clearance occurred normally, expansion and effector cytokine production by CD8⁺ T cells in response to LCMV infection was reduced in Itk^-/- mice.  These defects occurred independently of defects in Itk^-/- CD4 T cell function.  Clearance of vaccinia virus following infection was delayed in Itk^-/- mice compared to wild type mice (51).

ITK in T cell development

Consistent with impaired TCR signaling caused by ITK deficiency, thymocyte development is altered in Itk^-/- mice.  Competitive reconstitution with wild type and Itk^-/- bone marrow in irradiated mice revealed a disadvantage for Itk^-/- thymocytes at the double negative to double positive transition, although pre-TCR dependent selection was normal in Itk^-/- mice (52).  In addition, both positive and negative selection are impaired by ITK deficiency (53;54).  Defects in positive selection were most severe when the strength of the selecting TCR was weak (53).

Another effect of ITK deficiency on T cell development is to increase the frequency of memory or activated CD8 T cells that express CD44 (54-56).  These non-conventional CD8 T cells developed in the thymus, although they were selected independently of MHC expression on the thymic epithelium; instead they could be selected in an IL-4 and MHC I-dependent manner on hematopoietically-derived cells (57). They also expressed high levels of the transcription factor eomesodermin, produced IFN-γ rapidly upon PMA/ionomycin stimulation, and expressed several markers of memory T cells (57;58), making them similar to innate lymphocytes such as NKT cells.  Their development was partially attributed to a failure to upregulate IRF4 following TCR stimulation (59), and to reduced expression of the transcription factor Th-POK (60); these defects, respectively, redirect conventional CD8 T cell and CD4 T cell development toward activated/memory innate-like CD8 T cells.  A small frequency of CD4 T cells also showed innate-like characteristics: high CD44 expression, low CD62 expression, high eomesodermin expression (61;62).  The development of activated/memory T cells of both the CD8 and CD4 subsets was dependent on the transcription factor PLZF, and SAP, a component of the SLAM receptor signaling pathway present in hematopoietic cells but not thymic epithelial cells (62;63).

Itk^-/- mice exhibit elevated levels of serum IgE, a phenotype that stems from increased numbers of γδ NKT cells that produce abundant Th2 cytokines when stimulated, and express costimulatory molecules that provide B cell help (64-66).  These γδ NKT cells expressed Vγ1.1 and Vδ6.3, but also markers typical of αβ NKT cells including CD4, NK1.1, and PLZF.  In addition, they expressed activation/memory markers CD44 and CD69.  Overall, the γδ NKT cells in Itk^-/- mice exhibited αβ NKT cell phenotypes, producing both IFNγ and Th2 cytokines.  However, αβ NKT cell development was impaired in the absence of ITK, and those cells that remained exhibited defective IL-4 and IFNγ responses to TCR stimulation (67-69).

Putative Mechanism

Mice with the itxaro mutation of Itk displayed key phenotypes characteristic of ITK deficiency, including a reduced frequency of CD4 T cells, increased activated/memory CD4 and CD8 T cells, elevated CD44 expression on CD4 and CD8 T cells, and increased serum IgE.  The itxaro mutation affects a phenylalanine residue in the glycine-rich ATP binding loop, a sequence that is very highly conserved among protein kinases.  The mutation may abrogate ITK kinase activity, which is necessary for PLCγ1 activation during TCR signaling.

Primers

PCR Primer
itxaro_pcr_F: TTTACAAGCACAGCCGGGAC
itxaro_pcr_R: ACCCTGTAACAATCCTCTTGG

Sequencing Primer
itxaro_seq_F: GGACCCTCCTTCCCAGCATG
itxaro_seq_R: TAGTAACTACCTATGACACTCTAAGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 464 nucleotides is amplified (chromosome 11, - strand):

1   accctgtaac aatcctcttg gttaccttct ttatcatact tagcaccttt tctctcctta
61  ctctctcctg catcacaaca atttcaaagc catatcctat gttatagtaa ctacctatga
121 cactctaagc catctttgag ttatagtaac cataggttag ataagatgtt tctgagattc
181 atatcttatt aattgtccac tctaaaagca ttccctcttc ctctgttcca gggaagtggg
241 tgatccaacc ctcagagcta acgttcgtgc aggagattgg cagcgggcag tttgggctgg
301 tgcatctcgg ctactggctc aacaaggaca aggtggccat caagaccatt caggaagggg
361 cgatgtcaga agaagacttt atcgaggagg cggaagtcat gatgtgagtt agagcaggga
421 tgtgcaggca tgctgggaag gagggtcccg gctgtgcttg taaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Siliciano, J. D., Morrow, T. A., and Desiderio, S. V. (1992) Itk, a T-Cell-Specific Tyrosine Kinase Gene Inducible by Interleukin 2. Proc Natl Acad Sci U S A. 89, 11194-11198.

  2. Gibson, S., Leung, B., Squire, J. A., Hill, M., Arima, N., Goss, P., Hogg, D., and Mills, G. B. (1993) Identification, Cloning, and Characterization of a Novel Human T-Cell-Specific Tyrosine Kinase Located at the Hematopoietin Complex on Chromosome 5q. Blood. 82, 1561-1572.

  3. Heyeck, S. D., and Berg, L. J. (1993) Developmental Regulation of a Murine T-Cell-Specific Tyrosine Kinase Gene, Tsk. Proc Natl Acad Sci U S A. 90, 669-673.

  4. Tanaka, N., Asao, H., Ohtani, K., Nakamura, M., and Sugamura, K. (1993) A Novel Human Tyrosine Kinase Gene Inducible in T Cells by Interleukin 2. FEBS Lett. 324, 1-5.

  5. Yamada, N., Kawakami, Y., Kimura, H., Fukamachi, H., Baier, G., Altman, A., Kato, T., Inagaki, Y., and Kawakami, T. (1993) Structure and Expression of Novel Protein-Tyrosine Kinases, Emb and Emt, in Hematopoietic Cells. Biochem Biophys Res Commun. 192, 231-240.

  6. Heyeck, S. D., Wilcox, H. M., Bunnell, S. C., and Berg, L. J. (1997) Lck Phosphorylates the Activation Loop Tyrosine of the Itk Kinase Domain and Activates Itk Kinase Activity. J Biol Chem. 272, 25401-25408.

  7. Wilcox, H. M., and Berg, L. J. (2003) Itk Phosphorylation Sites are Required for Functional Activity in Primary T Cells. J Biol Chem. 278, 37112-37121.

  8. Joseph, R. E., Min, L., and Andreotti, A. H. (2007) The Linker between SH2 and Kinase Domains Positively Regulates Catalysis of the Tec Family Kinases. Biochemistry. 46, 5455-5462.

  9. Joseph, R. E., Severin, A., Min, L., Fulton, D. B., and Andreotti, A. H. (2009) SH2-Dependent Autophosphorylation within the Tec Family Kinase Itk. J Mol Biol. 391, 164-177.

  10. Min, L., Joseph, R. E., Fulton, D. B., and Andreotti, A. H. (2009) Itk Tyrosine Kinase Substrate Docking is Mediated by a Nonclassical SH2 Domain Surface of PLCgamma1. Proc Natl Acad Sci U S A. 106, 21143-21148.

  11. August, A., Sadra, A., Dupont, B., and Hanafusa, H. (1997) Src-Induced Activation of Inducible T Cell Kinase (ITK) Requires Phosphatidylinositol 3-Kinase Activity and the Pleckstrin Homology Domain of Inducible T Cell Kinase. Proc Natl Acad Sci U S A. 94, 11227-11232.

  12. Ching, K. A., Kawakami, Y., Kawakami, T., and Tsoukas, C. D. (1999) Emt/Itk Associates with Activated TCR Complexes: Role of the Pleckstrin Homology Domain. J Immunol. 163, 6006-6013.

  13. Huang, Y. H., Grasis, J. A., Miller, A. T., Xu, R., Soonthornvacharin, S., Andreotti, A. H., Tsoukas, C. D., Cooke, M. P., and Sauer, K. (2007) Positive Regulation of Itk PH Domain Function by Soluble IP4. Science. 316, 886-889.

  14. Hirve, N., Levytskyy, R. M., Rigaud, S., Guimond, D. M., Zal, T., Sauer, K., and Tsoukas, C. D. (2012) A Conserved Motif in the ITK PH-Domain is Required for Phosphoinositide Binding and TCR Signaling but Dispensable for Adaptor Protein Interactions. PLoS One. 7, e45158.

  15. Ching, K. A., Grasis, J. A., Tailor, P., Kawakami, Y., Kawakami, T., and Tsoukas, C. D. (2000) TCR/CD3-Induced Activation and Binding of Emt/Itk to Linker of Activated T Cell Complexes: Requirement for the Src Homology 2 Domain. J Immunol. 165, 256-262.

  16. Brazin, K. N., Fulton, D. B., and Andreotti, A. H. (2000) A Specific Intermolecular Association between the Regulatory Domains of a Tec Family Kinase. J Mol Biol. 302, 607-623.

  17. Severin, A., Joseph, R. E., Boyken, S., Fulton, D. B., and Andreotti, A. H. (2009) Proline Isomerization Preorganizes the Itk SH2 Domain for Binding to the Itk SH3 Domain. J Mol Biol. 387, 726-743.

  18. Vihinen, M., Nilsson, L., and Smith, C. I. (1994) Tec Homology (TH) Adjacent to the PH Domain. FEBS Lett. 350, 263-265.

  19. Huang, W., Morales, J. L., Gazivoda, V. P., Lai, J., Qi, Q., and August, A. (2013) The Zinc-Binding Region of IL-2 Inducible T Cell Kinase (Itk) is Required for Interaction with Galpha13 and Activation of Serum Response Factor. Int J Biochem Cell Biol. 45, 1074-1082.

  20. Hao, S., Qi, Q., Hu, J., and August, A. (2006) A Kinase Independent Function for Tec Kinase ITK in Regulating Antigen Receptor Induced Serum Response Factor Activation. FEBS Lett. 580, 2691-2697.

  21. Brown, K., Long, J. M., Vial, S. C., Dedi, N., Dunster, N. J., Renwick, S. B., Tanner, A. J., Frantz, J. D., Fleming, M. A., and Cheetham, G. M. (2004) Crystal Structures of Interleukin-2 Tyrosine Kinase and their Implications for the Design of Selective Inhibitors. J Biol Chem. 279, 18727-18732.

  22. Kutach, A. K., Villasenor, A. G., Lam, D., Belunis, C., Janson, C., Lok, S., Hong, L. N., Liu, C. M., Deval, J., Novak, T. J., Barnett, J. W., Chu, W., Shaw, D., and Kuglstatter, A. (2010) Crystal Structures of IL-2-Inducible T Cell Kinase Complexed with Inhibitors: Insights into Rational Drug Design and Activity Regulation. Chem Biol Drug Des. 76, 154-163.

  23. Charrier, J. D., Miller, A., Kay, D. P., Brenchley, G., Twin, H. C., Collier, P. N., Ramaya, S., Keily, S. B., Durrant, S. J., Knegtel, R. M., Tanner, A. J., Brown, K., Curnock, A. P., and Jimenez, J. M. (2011) Discovery and Structure-Activity Relationship of 3-Aminopyrid-2-Ones as Potent and Selective Interleukin-2 Inducible T-Cell Kinase (Itk) Inhibitors. J Med Chem. 54, 2341-2350.

  24. McLean, L. R., Zhang, Y., Zaidi, N., Bi, X., Wang, R., Dharanipragada, R., Jurcak, J. G., Gillespy, T. A., Zhao, Z., Musick, K. Y., Choi, Y. M., Barrague, M., Peppard, J., Smicker, M., Duguid, M., Parkar, A., Fordham, J., and Kominos, D. (2012) X-Ray Crystallographic Structure-Based Design of Selective Thienopyrazole Inhibitors for Interleukin-2-Inducible Tyrosine Kinase. Bioorg Med Chem Lett. 22, 3296-3300.

  25. Han, S., Czerwinski, R. M., Caspers, N. L., Limburg, D. C., Ding, W., Wang, H., Ohren, J. F., Rajamohan, F., McLellan, T. J., Unwalla, R., Choi, C., Parikh, M. D., Seth, N., Edmonds, J., Phillips, C., Shakya, S., Li, X., Spaulding, V., Hughes, S., Cook, A., Robinson, C., Mathias, J. P., Navratilova, I., Medley, Q. G., Anderson, D. R., Kurumbail, R. G., and Aulabaugh, A. (2014) Selectively Targeting an Inactive Conformation of Interleukin-2-Inducible T-Cell Kinase by Allosteric Inhibitors. Biochem J. 460, 211-222.

  26. Burch, J. D., Barrett, K., Chen, Y., DeVoss, J., Eigenbrot, C., Goldsmith, R., Ismaili, M. H., Lau, K., Lin, Z., Ortwine, D. F., Zarrin, A. A., McEwan, P. A., Barker, J. J., Ellebrandt, C., Kordt, D., Stein, D. B., Wang, X., Chen, Y., Hu, B., Xu, X., Yuen, P. W., Zhang, Y., and Pei, Z. (2015) Tetrahydroindazoles as Interleukin-2 Inducible T-Cell Kinase Inhibitors. Part II. Second-Generation Analogues with Enhanced Potency, Selectivity, and Pharmacodynamic Modulation in Vivo. J Med Chem. 58, 3806-3816.

  27. Andreotti, A. H., Schwartzberg, P. L., Joseph, R. E., and Berg, L. J. (2010) T-Cell Signaling Regulated by the Tec Family Kinase, Itk. Cold Spring Harb Perspect Biol. 2, a002287.

  28. Smith-Garvin, J. E., Koretzky, G. A., and Jordan, M. S. (2009) T Cell Activation. Annu Rev Immunol. 27, 591-619.

  29. Joseph, R. E., Fulton, D. B., and Andreotti, A. H. (2007) Mechanism and Functional Significance of Itk Autophosphorylation. J Mol Biol. 373, 1281-1292.

  30. Schaeffer, E. M., Debnath, J., Yap, G., McVicar, D., Liao, X. C., Littman, D. R., Sher, A., Varmus, H. E., Lenardo, M. J., and Schwartzberg, P. L. (1999) Requirement for Tec Kinases Rlk and Itk in T Cell Receptor Signaling and Immunity. Science. 284, 638-641.

  31. Houtman, J. C., Houghtling, R. A., Barda-Saad, M., Toda, Y., and Samelson, L. E. (2005) Early Phosphorylation Kinetics of Proteins Involved in Proximal TCR-Mediated Signaling Pathways. J Immunol. 175, 2449-2458.

  32. Bogin, Y., Ainey, C., Beach, D., and Yablonski, D. (2007) SLP-76 Mediates and Maintains Activation of the Tec Family Kinase ITK Via the T Cell Antigen Receptor-Induced Association between SLP-76 and ITK. Proc Natl Acad Sci U S A. 104, 6638-6643.

  33. Joseph, R. E., Min, L., Xu, R., Musselman, E. D., and Andreotti, A. H. (2007) A Remote Substrate Docking Mechanism for the Tec Family Tyrosine Kinases. Biochemistry. 46, 5595-5603.

  34. Liu, K. Q., Bunnell, S. C., Gurniak, C. B., and Berg, L. J. (1998) T Cell Receptor-Initiated Calcium Release is Uncoupled from Capacitative Calcium Entry in Itk-Deficient T Cells. J Exp Med. 187, 1721-1727.

  35. Liao, X. C., and Littman, D. R. (1995) Altered T Cell Receptor Signaling and Disrupted T Cell Development in Mice Lacking Itk. Immunity. 3, 757-769.

  36. Fowell, D. J., Shinkai, K., Liao, X. C., Beebe, A. M., Coffman, R. L., Littman, D. R., and Locksley, R. M. (1999) Impaired NFATc Translocation and Failure of Th2 Development in Itk-Deficient CD4+ T Cells. Immunity. 11, 399-409.

  37. Schaeffer, E. M., Yap, G. S., Lewis, C. M., Czar, M. J., McVicar, D. W., Cheever, A. W., Sher, A., and Schwartzberg, P. L. (2001) Mutation of Tec Family Kinases Alters T Helper Cell Differentiation. Nat Immunol. 2, 1183-1188.

  38. Au-Yeung, B. B., Katzman, S. D., and Fowell, D. J. (2006) Cutting Edge: Itk-Dependent Signals Required for CD4+ T Cells to Exert, but Not Gain, Th2 Effector Function. J Immunol. 176, 3895-3899.

  39. Mueller, C., and August, A. (2003) Attenuation of Immunological Symptoms of Allergic Asthma in Mice Lacking the Tyrosine Kinase ITK. J Immunol. 170, 5056-5063.

  40. Ferrara, T. J., Mueller, C., Sahu, N., Ben-Jebria, A., and August, A. (2006) Reduced Airway Hyperresponsiveness and Tracheal Responses during Allergic Asthma in Mice Lacking Tyrosine Kinase Inducible T-Cell Kinase. J Allergy Clin Immunol. 117, 780-786.

  41. Kannan, A. K., Sahu, N., Mohanan, S., Mohinta, S., and August, A. (2013) IL-2-Inducible T-Cell Kinase Modulates TH2-Mediated Allergic Airway Inflammation by Suppressing IFN-Gamma in Naive CD4+ T Cells. J Allergy Clin Immunol. 132, 811-20.e1-5.

  42. Miller, A. T., Wilcox, H. M., Lai, Z., and Berg, L. J. (2004) Signaling through Itk Promotes T Helper 2 Differentiation Via Negative Regulation of T-Bet. Immunity. 21, 67-80.

  43. Sahu, N., Venegas, A. M., Jankovic, D., Mitzner, W., Gomez-Rodriguez, J., Cannons, J. L., Sommers, C., Love, P., Sher, A., Schwartzberg, P. L., and August, A. (2008) Selective Expression rather than Specific Function of Txk and Itk Regulate Th1 and Th2 Responses. J Immunol. 181, 6125-6131.

  44. Cho, H. S., Shin, H. M., Haberstock-Debic, H., Xing, Y., Owens, T. D., Funk, J. O., Hill, R. J., Bradshaw, J. M., and Berg, L. J. (2015) A Small Molecule Inhibitor of ITK and RLK Impairs Th1 Differentiation and Prevents Colitis Disease Progression. J Immunol. 195, 4822-4831.

  45. Fischer, A. M., Mercer, J. C., Iyer, A., Ragin, M. J., and August, A. (2004) Regulation of CXC Chemokine Receptor 4-Mediated Migration by the Tec Family Tyrosine Kinase ITK. J Biol Chem. 279, 29816-29820.

  46. Takesono, A., Horai, R., Mandai, M., Dombroski, D., and Schwartzberg, P. L. (2004) Requirement for Tec Kinases in Chemokine-Induced Migration and Activation of Cdc42 and Rac. Curr Biol. 14, 917-922.

  47. Gomez-Rodriguez, J., Sahu, N., Handon, R., Davidson, T. S., Anderson, S. M., Kirby, M. R., August, A., and Schwartzberg, P. L. (2009) Differential Expression of Interleukin-17A and -17F is Coupled to T Cell Receptor Signaling Via Inducible T Cell Kinase. Immunity. 31, 587-597.

  48. Wang, X., Zhang, Y., Yang, X. O., Nurieva, R. I., Chang, S. H., Ojeda, S. S., Kang, H. S., Schluns, K. S., Gui, J., Jetten, A. M., and Dong, C. (2012) Transcription of Il17 and Il17f is Controlled by Conserved Noncoding Sequence 2. Immunity. 36, 23-31.

  49. Gomez-Rodriguez, J., Wohlfert, E. A., Handon, R., Meylan, F., Wu, J. Z., Anderson, S. M., Kirby, M. R., Belkaid, Y., and Schwartzberg, P. L. (2014) Itk-Mediated Integration of T Cell Receptor and Cytokine Signaling Regulates the Balance between Th17 and Regulatory T Cells. J Exp Med. 211, 529-543.

  50. Atherly, L. O., Brehm, M. A., Welsh, R. M., and Berg, L. J. (2006) Tec Kinases Itk and Rlk are Required for CD8+ T Cell Responses to Virus Infection Independent of their Role in CD4+ T Cell Help. J Immunol. 176, 1571-1581.

  51. Bachmann, M. F., Littman, D. R., and Liao, X. C. (1997) Antiviral Immune Responses in Itk-Deficient Mice. J Virol. 71, 7253-7257.

  52. Lucas, J. A., Felices, M., Evans, J. W., and Berg, L. J. (2007) Subtle Defects in Pre-TCR Signaling in the Absence of the Tec Kinase Itk. J Immunol. 179, 7561-7567.

  53. Lucas, J. A., Atherly, L. O., and Berg, L. J. (2002) The Absence of Itk Inhibits Positive Selection without Changing Lineage Commitment. J Immunol. 168, 6142-6151.

  54. Schaeffer, E. M., Broussard, C., Debnath, J., Anderson, S., McVicar, D. W., and Schwartzberg, P. L. (2000) Tec Family Kinases Modulate Thresholds for Thymocyte Development and Selection. J Exp Med. 192, 987-1000.

  55. Atherly, L. O., Lucas, J. A., Felices, M., Yin, C. C., Reiner, S. L., and Berg, L. J. (2006) The Tec Family Tyrosine Kinases Itk and Rlk Regulate the Development of Conventional CD8+ T Cells. Immunity. 25, 79-91.

  56. Dubois, S., Waldmann, T. A., and Muller, J. R. (2006) ITK and IL-15 Support Two Distinct Subsets of CD8+ T Cells. Proc Natl Acad Sci U S A. 103, 12075-12080.

  57. Broussard, C., Fleischacker, C., Horai, R., Chetana, M., Venegas, A. M., Sharp, L. L., Hedrick, S. M., Fowlkes, B. J., and Schwartzberg, P. L. (2006) Altered Development of CD8+ T Cell Lineages in Mice Deficient for the Tec Kinases Itk and Rlk. Immunity. 25, 93-104.

  58. Hu, J., Sahu, N., Walsh, E., and August, A. (2007) Memory Phenotype CD8+ T Cells with Innate Function Selectively Develop in the Absence of Active Itk. Eur J Immunol. 37, 2892-2899.

  59. Nayar, R., Enos, M., Prince, A., Shin, H., Hemmers, S., Jiang, J. K., Klein, U., Thomas, C. J., and Berg, L. J. (2012) TCR Signaling Via Tec Kinase ITK and Interferon Regulatory Factor 4 (IRF4) Regulates CD8+ T-Cell Differentiation. Proc Natl Acad Sci U S A. 109, E2794-802.

  60. Hu, J., Qi, Q., and August, A. (2010) Itk Derived Signals Regulate the Expression of Th-POK and Controls the Development of CD4 T Cells. PLoS One. 5, e8891.

  61. Hu, J., and August, A. (2008) Naive and Innate Memory Phenotype CD4+ T Cells have Different Requirements for Active Itk for their Development. J Immunol. 180, 6544-6552.

  62. Prince, A. L., Kraus, Z., Carty, S. A., Ng, C., Yin, C. C., Jordan, M. S., Schwartzberg, P. L., and Berg, L. J. (2014) Development of Innate CD4+ and CD8+ T Cells in Itk-Deficient Mice is Regulated by Distinct Pathways. J Immunol. 193, 688-699.

  63. Horai, R., Mueller, K. L., Handon, R. A., Cannons, J. L., Anderson, S. M., Kirby, M. R., and Schwartzberg, P. L. (2007) Requirements for Selection of Conventional and Innate T Lymphocyte Lineages. Immunity. 27, 775-785.

  64. Felices, M., Yin, C. C., Kosaka, Y., Kang, J., and Berg, L. J. (2009) Tec Kinase Itk in gammadeltaT Cells is Pivotal for Controlling IgE Production in Vivo. Proc Natl Acad Sci U S A. 106, 8308-8313.

  65. Qi, Q., Xia, M., Hu, J., Hicks, E., Iyer, A., Xiong, N., and August, A. (2009) Enhanced Development of CD4+ Gammadelta T Cells in the Absence of Itk Results in Elevated IgE Production. Blood. 114, 564-571.

  66. Yin, C. C., Cho, O. H., Sylvia, K. E., Narayan, K., Prince, A. L., Evans, J. W., Kang, J., and Berg, L. J. (2013) The Tec Kinase ITK Regulates Thymic Expansion, Emigration, and Maturation of Gammadelta NKT Cells. J Immunol. 190, 2659-2669.

  67. Gadue, P., and Stein, P. L. (2002) NK T Cell Precursors Exhibit Differential Cytokine Regulation and Require Itk for Efficient Maturation. J Immunol. 169, 2397-2406.

  68. Au-Yeung, B. B., and Fowell, D. J. (2007) A Key Role for Itk in both IFN Gamma and IL-4 Production by NKT Cells. J Immunol. 179, 111-119.

  69. Felices, M., and Berg, L. J. (2008) The Tec Kinases Itk and Rlk Regulate NKT Cell Maturation, Cytokine Production, and Survival. J Immunol. 180, 3007-3018.