Phenotypic Mutation 'don_knotts' (pdf version)
Mutation Type missense
Coordinate66,841,172 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Tlr4
Gene Name toll-like receptor 4
Synonym(s) Rasl2-8, Lps, lipopolysaccharide response
Chromosomal Location 66,827,584-66,930,284 bp (+)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021297.2; MGI:96824

Mapped Yes 
Amino Acid Change Valine changed to Alanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000045770] [ENSMUSP00000102988]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: V734A

LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000048096)
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS B220 MFI - increased
FACS IgD+ B cell percentage - decreased
FACS IgM+ B cells - decreased
TLR signaling defect: hyposensitivity to LPS 10549626
TLR signaling defect: TNF production by macrophages
Alleles Listed at MGI

All mutations/alleles(14) : Chemically induced (ENU)(3) Spontaneous(6) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 splice site probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 critical splice donor site probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038215-MU
Last Updated 2016-12-09 10:21 AM by Katherine Timer
Record Created 2015-09-14 8:29 AM
Record Posted 2015-09-22
Phenotypic Description

Figure 1. Don_knotts mice exhibited reduced TNFα secretion in response to the TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown from gene-based superpedigree analysis. Data shown for pedigrees R1929 (green), R1888 (red), R3011 (purple), R1488 (cyan), and R0827 (gold). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Don_knotts mice exhibit decreased frequencies of peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Don_knotts mice exhibit a decreased percentage of peripheral blood IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Don_knotts mice exhibit decreased frequencies of peripheral blood IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Don_knotts mice exhibit increased B220 mean fluorescence intensity on B cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI on B cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The don_knotts phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1888 using gene-based superpedigree analysis for mice deficient in TNFα secretion from macrophages in response to the Toll-like receptor 4 (TLR4) ligand, lipolysaccharide (LPS) (Figure 1). A mouse in pedigree R1888 also exhibited reduced B cell frequency (Figure 2) including IgD+ B cells (Figure 3) and IgM+ B cells (Figure 4), and an increased B220 mean fluorescence intensity on B cells (Figure 5), all in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of the reduced TNFα secretion after LPS stimulation using an additive model of inheritance and gene-based superpedigree analysis. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 109 mutations identified in the G1 male of pedigree R0827, 99 mutations identified in the G1 male of pedigree R1888, 33 mutations identified in the G1 male of pedigree R3011, 55 mutations identified in the G1 male of pedigree R1488, and 87 mutations identified in the G1 male of pedigree R0827 (X-axis). Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 99 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tlr4:  a T to C transition at base pair 66,841,172 (v38) on chromosome 4, or base pair 13,362 in the NC_000070 GenBank genomic region. The strongest association was found with an additive model of linkage using gene-based superpedigree analysis to the normalized amount of TNFα secretion in response to LPS, wherein wherein 12 variant homozygotes from five pedigrees exhibiting either null of missense Tlr4 alleles departed phenotypically from 45 homozygous reference mice and 67 heterozygous mice with a P value of 4.878 x 10-5 (Figure 6).  A substantial semidominant effect was observed in the TLR4 signaling assay, but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 


The mutation corresponds to residue 2,482 in the mRNA sequence NM_021297 within exon 3 of 3 total exons.



729  -R--K--V--I--V--V--V--S--R--H--F-


The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to alanine (A) substitution at position 734 (V734A) in the TLR4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 7. Protein and domain structure of TLR4. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the Lps3 mutation is highlighted. 3D image was created using UCSF Chimera. B) TLR4 is an 835 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The don_knotts mutation (red asterisk) results in an a valine (V) to alanine (A) substitution at position 734 (V734A) in the TLR4 protein. This image is interactive. Click on the image to view other mutations found in TLR4 (red). Click on the mutations for more specific information.

TLR4 is a type I integral membrane glycoprotein containing 835 amino acids. TLR4 has 22 predicted leucine-rich repeats (LRRs) in its ectodomain at the N-terminal half of the protein (1-3), a transmembrane domain, and a cytoplasmic Toll/IL-1R (TIR) domain (Figure 7). The don_knotts mutation results in a valine (V) to alanine (A) substitution at position 734 (V734A) in TLR4. V734 is within the TIR domain. 


Please see the record for lps3 for information about Tlr4.

Putative Mechanism

TLR4 is the receptor for LPS (4). Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif) (5-7). The MyD88-dependent pathway activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon (IFN), cytokines required for the inflammatory response. The MyD88-independent pathway results in the production of type I IFN. The reduction in TLR4-associated responses in don_knotts indicates that the mutation results in loss of TLR4 function.

Primers PCR Primer
don_knotts(R):5'- TCTCCAGAAGATGTGCCTCC -3'

Sequencing Primer
don_knotts_seq(R):5'- AGAAGATGTGCCTCCCCAGAG -3'

1. Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., and Bazan, J. F. (1998) A Family of Human Receptors Structurally Related to Drosophila Toll. Proc Natl Acad Sci U S A. 95, 588-593.

  2. Medzhitov, R., Preston-Hurlburt, P., and Janeway, C. A.,Jr. (1997) A Human Homologue of the Drosophila Toll Protein Signals Activation of Adaptive Immunity. Nature. 388, 394-397.

  3. Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-Rich Repeats and Pathogen Recognition in Toll-Like Receptors. Trends Immunol. 24, 528-533.

  4. Poltorak, A., He, X., Smirnova, I., Liu, M. -., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS Signaling in C3H/HeJ and C57BL/10ScCr Mice: Mutations in Tlr4 gene. Science. 282, 2085-2088.

  5. Kawai, T., Adachi, O., Ogawa, T., Takeda, K., and Akira, S. (1999) Unresponsiveness of MyD88-Deficient Mice to Endotoxin. Immunity. 11, 115-122.

  6. Hoshino, K., Kaisho, T., Iwabe, T., Takeuchi, O., and Akira, S. (2002) Differential Involvement of IFN-Beta in Toll-Like Receptor-Stimulated Dendritic Cell Activation. Int Immunol. 14, 1225-1231.

  7. Kawai, T., Takeuchi, O., Fujita, T., Inoue, J., Muhlradt, P. F., Sato, S., Hoshino, K., and Akira, S. (2001) Lipopolysaccharide Stimulates the MyD88-Independent Pathway and Results in Activation of IFN-Regulatory Factor 3 and the Expression of a Subset of Lipopolysaccharide-Inducible Genes. J Immunol. 167, 5887-5894.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsYing Wang, Bruce Beutler