Phenotypic Mutation 'yellowstone' (pdf version)
List |< first << previous [record 576 of 584] next >> last >|
Alleleyellowstone
Mutation Type missense
Chromosome18
Coordinate65,458,200 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Malt1
Gene Name mucosa associated lymphoid tissue lymphoma translocation gene 1
Synonym(s) paracaspase, D430033E09Rik
Chromosomal Location 65,430,963-65,478,823 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_172833; MGI:2445027

Mapped Yes 
Amino Acid Change Asparagine changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000048376] [ENSMUSP00000153585]
SMART Domains Protein: ENSMUSP00000048376
Gene: ENSMUSG00000032688
AA Change: N347K

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
PDB:2G7R|B 52 132 3e-29 PDB
IGc2 145 203 8.19e-9 SMART
IGc2 248 306 2.88e-4 SMART
Pfam:Peptidase_C14 340 557 1.4e-19 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000049248)
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000224056)
Phenotypic Category Autosomal Recessive
Penetrance  
Alleles Listed at MGI

All mutations/alleles(9) : Chemically induced (ENU)(1) Gene trapped(3) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Malt1 APN 18 65448963 nonsense probably null
IGL01354:Malt1 APN 18 65475191 missense probably damaging 1.00
IGL01514:Malt1 APN 18 65476400 missense possibly damaging 0.74
IGL01968:Malt1 APN 18 65449016 unclassified probably benign 0.27
bryce_canyon UTSW 18 65462915 critical splice donor site probably null
mousebird UTSW 18 65475260 critical splice donor site probably null
H8930:Malt1 UTSW 18 65462815 nonsense probably null
R0319:Malt1 UTSW 18 65462915 critical splice donor site probably null
R0512:Malt1 UTSW 18 65458200 missense probably damaging 1.00
R0748:Malt1 UTSW 18 65475260 critical splice donor site probably null
R2085:Malt1 UTSW 18 65473147 missense probably damaging 1.00
R2962:Malt1 UTSW 18 65448335 missense probably benign 0.01
R4193:Malt1 UTSW 18 65447675 missense probably benign 0.00
R4359:Malt1 UTSW 18 65476229 missense probably benign 0.00
R4913:Malt1 UTSW 18 65476280 missense probably damaging 1.00
R5201:Malt1 UTSW 18 65476055 missense probably benign
R5925:Malt1 UTSW 18 65431368 missense possibly damaging 0.86
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038220-MU
Last Updated 2016-05-13 3:09 PM by Anne Murray
Record Created 2015-09-15 2:23 PM
Record Posted 2015-09-24
Phenotypic Description
Figure 1. Homozygous yellowstone mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown from gene-based superpedigree analysis of three pedigrees R0512 (aqua), R0319 (gold), and R0748 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Homozygous yellowstone mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown from gene-based superpedigree analysis of three pedigrees R0512 (aqua), R0319 (gold), and R0748 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Homozygous yellowstone mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown from gene-based superpedigree analysis of three pedigrees R0512 (aqua), R0319 (gold), and R0748 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The yellowstone phenotype was identified by gene-based superpedigree analysis among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0512, some of which showed diminished T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 1) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 2). The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also diminished (Figure 3). 

Nature of Mutation
Figure 4. Linkage mapping of the reduced T-dependent IgG responses to rSFV-β-gal using a recessive model of inheritance and gene-based superpedigree analysis. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 177 mutations (X-axis) identified in the G1 males of pedigrees R0512 (contributing 92 mutations), R0319 (contributing 56 mutation), and R0748 (contributing 29 mutations) using gene-based superpedigree analysis.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire in the R0512 pedigree identified 92 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Malt1 by gene-based superpedigree analysis:  a T to A transition at base pair 65,458,200 (v38) on chromosome 18, or base pair 27,332 in the NC_000071 GenBank genomic region.  The strongest association was found with a recessive model of linkage to the T-dependent antibody response to rSFV-β-gal, wherein five variant homozygotes from three pedigrees departed phenotypically from 29 homozygous reference mice and 45 heterozygous mice with a P value of 4.604 x 10-9 (Figure 4). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 1,216 in the mRNA sequence NM_172833 within exon 9 of 16 total exons.

 

1199 GCCCTTTTGATAGGGAATATGAGTTACTGGGAG
342  -A--L--L--I--G--N--M--S--Y--W--E-

 

The mutated nucleotide is indicated in red.  The mutation results in an asparagine (N) to lysine (K) substitution at position 347 (N347K) in the MALT1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

 

Protein Prediction
Figure 5. Domain structure of MALT1. The location of the yellowstone mutation is indicated. The mutation results in an asparagine (N) to lysine (K) substitution at position 347 (N347K). Abbreviations: DD, death domain, Ig, immunoglobulin-like.

Malt1 encodes mucosa-associated lymphoid tissue translocation gene 1 (MALT1; alternatively paracaspase; Figure 5). MALT1 has several domains including a death domain (DD; amino acids 45-132), a paracaspase domain (amino acids 340-535), and three immunoglobulin (Ig)-like domains [amino acids 145-203 (Ig1), 248-306 (Ig2), and 581-715 (Ig3)] (1). The mutation in yellowstone results in an asparagine (N) to lysine (K) substitution at position 347. Lys347 is within the paracaspase domain. The paracaspase domain of MALT1 is essential for its catalytic function. The paracaspase domain of MALT1 may directly associate with CARMA1 (alternatively, CARD11; see the record for king) within the CARMA1/BCL10/MALT (CBM) complex.

 

For more information about Malt1, please see the record mousebird.

Putative Mechanism

Upon T cell activation by the TCR and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 and recruits these proteins to lipid rafts of the immunological synapse and to form a scaffold for the assembly of several signaling complexes including those that involve TNF receptor-associated factor 6 (TRAF6), TGF (transforming growth factor)-β-activated kinase 1 (TAK1), and NF-κB essential modulator (NEMO; see the record for panr2) to facilitate NF-κB activation and lymphocyte stimulation. In addition to T and B cells, MALT1 functions in mast cells, dendritic cells, macrophages and natural killer (NK) cells (2-4). Malt1-/- mice exhibit defective antigen receptor-induced lymphocyte activation (5;6). Malt1-/- mice exhibited reduced T-dependent antibody responses to keyhole limpet haemocyanin (KLH) in complete Freund's adjuvant (CFA) and 2,4-dinitrophenol–conjugated ovalbumin (DNP-OVA) as well as reduced T-independent antibody responses to tri-nitrophenol-(TNP)-Ficoll (5-7). The yellowstone mice also exhibit defects in both T-independent and T-dependent antibody responses indicating that the MALT1yellowstone protein exhibits loss-of-function.

Primers PCR Primer
yellowstone(F):5'- GCTCAGAGGAGATAGCTCATCCACA -3'
yellowstone(R):5'- GTGCAGCACTGTATGCCAGGAA -3'

Sequencing Primer
yellowstone_seq(F):5'- GGAAAAAAAGTCCTTGTGAAATACC -3'
yellowstone_seq(R):5'- gcagagtcatctcttcagcc -3'
References

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 576 of 584] next >> last >|