Phenotypic Mutation 'bryce_canyon' (pdf version)
List |< first << previous [record 42 of 511] next >> last >|
Mutation Type critical splice donor site (2 bp from exon)
Coordinate65,462,915 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Malt1
Gene Name mucosa associated lymphoid tissue lymphoma translocation gene 1
Synonym(s) paracaspase, D430033E09Rik
Chromosomal Location 65,430,963-65,478,823 bp (+)
MGI Phenotype Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation.
Accession Number

NCBI RefSeq: NM_172833; MGI:2445027

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000048376
Gene: ENSMUSG00000032688

low complexity region 19 35 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
PDB:2G7R|B 52 132 3e-29 PDB
IGc2 145 203 8.19e-9 SMART
IGc2 248 306 2.88e-4 SMART
Pfam:Peptidase_C14 340 557 1.4e-19 PFAM
Predicted Effect probably null
Phenotypic Category T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Alleles Listed at MGI

All mutations/alleles(9) : Chemically induced (ENU)(1) Gene trapped(3) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Malt1 APN 18 65448963 nonsense probably null 0.00
IGL01354:Malt1 APN 18 65475191 missense probably damaging 0.99
IGL01514:Malt1 APN 18 65476400 missense possibly damaging 0.61
IGL01968:Malt1 APN 18 65449016 missense probably benign 0.16
mousebird UTSW 18 65475260 critical splice donor site probably null
yellowstone UTSW 18 65458200 missense probably damaging 1.00
H8930:Malt1 UTSW 18 65462815 nonsense probably null
R0748:Malt1 UTSW 18 65475260 critical splice donor site probably null
R2085:Malt1 UTSW 18 65473147 missense probably damaging 1.00
R2962:Malt1 UTSW 18 65448335 missense probably benign 0.00
R4193:Malt1 UTSW 18 65447675 missense probably benign 0.00
R4359:Malt1 UTSW 18 65476229 missense probably benign 0.00
R4913:Malt1 UTSW 18 65476280 missense probably damaging 1.00
R5201:Malt1 UTSW 18 65476055 missense probably benign 0.00
R5925:Malt1 UTSW 18 65431368 missense possibly damaging 0.86
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission
Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 09/15/2015 2:27 PM
Record Posted 09/24/2015
Phenotypic Description
Figure 1. Homozygous bryce_canyon mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown from gene-based superpedigree analysis of three pedigrees R0512 (aqua), R0319 (gold), and R0748 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous bryce_canyon mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown from gene-based superpedigree analysis of three pedigrees R0512 (aqua), R0319 (gold), and R0748 (red). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous bryce_canyon mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown from gene-based superpedigree analysis of three pedigrees R0319 (gold) and R0748 (aqua). Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The bryce_canyon phenotype was identified by gene-based superpedigree analysis among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0319, some of which showed diminished T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 1) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 2). The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also diminished (Figure 3). 

Nature of Mutation

Figure 4. Linkage mapping of the reduced T-dependent IgG responses to rSFV-β-gal using a recessive model of inheritance and gene-based superpedigree analysis. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 177 mutations (X-axis) identified in the G1 males of pedigrees R0512 (contributing 92 mutations), R0319 (contributing 56 mutation), and R0748 (contributing 29 mutations) using gene-based superpedigree analysis.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire in the R0319 pedigree identified 56 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Malt1 by gene-based superpedigree analysis:  a T to C transition at base pair 65,462,915 (v38) on chromosome 18, or base pair 31,947 in the NC_000084 GenBank genomic region within the donor splice site of intron 10 (2 base pairs from exon 10).  The strongest association was found with a recessive model of linkage to the T-dependent antibody response to rSFV-β-gal, wherein five variant homozygotes from three pedigrees departed phenotypically from 29 homozygous reference mice and 45 heterozygous mice with a P value of 4.604 x 10-9 (Figure 4). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 


The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 178-base pair exon 10 (out of 16 total exons), resulting in a frame-shift and coding of 13 aberrant amino acids followed by a premature stop codon within exon 11 (after amino acid 418).


               <--exon 9       <--exon 10 intron 10-->          exon 11-->


400   ……-D--K--G--V--Y-- ……-M--C--R--K--R                       E--M--T--S-……-W--T--H--*    418

            correct           deleted                                   aberrant


Genomic numbering corresponds to NC_000084. The donor splice site of intron 11, which is destroyed by the bryce_canyon mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 


Protein Prediction
Figure 5. Domain structure of MALT1. The location of the bryce_canyon mutation within intron 11 is indicated. Abbreviations: DD, death domain, Ig, immunoglobulin-like.

Malt1 encodes mucosa-associated lymphoid tissue translocation gene 1 (MALT1; alternatively paracaspase; Figure 5). MALT1 has several domains including a death domain (DD; amino acids 45-132), a paracaspase domain (amino acids 340-535), and three immunoglobulin (Ig)-like domains [amino acids 145-203 (Ig1), 248-306 (Ig2), and 581-715 (Ig3)] (1). The mutation in bryce_canyon is predicted to result in deletion of amino acids 406-464 as well as a frameshift after amino acid 405, coding of 13 aberrant amino acids followed by a premature stop codon.


For more information about Malt1, please see the record mousebird.

Putative Mechanism

Upon T cell activation by the TCR and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 and recruits these proteins to lipid rafts of the immunological synapse and to form a scaffold for the assembly of several signaling complexes including those that involve TNF receptor-associated factor 6 (TRAF6), TGF (transforming growth factor)-β-activated kinase 1 (TAK1), and NF-κB essential modulator (NEMO; see the record for panr2) to facilitate NF-κB activation and lymphocyte stimulation. In addition to T and B cells, MALT1 functions in mast cells, dendritic cells, macrophages and natural killer (NK) cells (2-4). Malt1-/- mice exhibit defective antigen receptor-induced lymphocyte activation (5;6). Malt1-/- mice exhibited reduced T-dependent antibody responses to keyhole limpet haemocyanin (KLH) in complete Freund's adjuvant (CFA) and 2,4-dinitrophenol–conjugated ovalbumin (DNP-OVA) as well as reduced T-independent antibody responses to tri-nitrophenol-(TNP)-Ficoll (5-7). The bryce_canyon mice also exhibit defects in both T-independent and T-dependent antibody responses indicating that the MALT1bryce_canyon protein, if expressed, exhibits loss-of-function.

Primers PCR Primer

Sequencing Primer
bryce_canyon_seq(F):5'- GGCACGGTTATGAAAACTTTGG -3'
bryce_canyon_seq(R):5'- TATAACTTGTACCTTTCACAGCAAAC -3'
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJin Huk Choi, Kuan-Wen Wang, and Bruce Beutler
List |< first << previous [record 42 of 511] next >> last >|