Phenotypic Mutation 'lackadaisical' (pdf version)
Allelelackadaisical
Mutation Type missense
Chromosome9
Coordinate119,338,692 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Myd88
Gene Name myeloid differentiation primary response gene 88
Chromosomal Location 119,335,934-119,341,411 bp (-)
MGI Phenotype Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology.
Accession Number

NCBI RefSeq: NM_010851; MGI: 108005

Mapped Yes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Ref Sequences
Y116C in Ensembl: ENSMUSP00000035092 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
DEATH 19 109 7.17e-15 SMART
TIR 160 296 3.39e-25 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.996 (Sensitivity: 0.54; Specificity: 0.98)
(Using Ensembl: ENSMUSP00000035092)
Phenotypic Category immune system, TLR signaling defect: TNF production by macrophages, TLR signaling defect: type I IFN production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(3) Chemically induced(2

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Myd88 APN 9 119337352 splice site noncoding transcript
Dani_alves UTSW 9 119337823 missense possibly damaging 0.69
Myd88rev1 UTSW 9 119337394 missense probably damaging 0.99
pococurante UTSW 9 119338114 missense probably damaging 1.00
R1695:Myd88 UTSW 9 119337842 nonsense probably null
R1878:Myd88 UTSW 9 119338620 missense probably benign 0.00
R2413:Myd88 UTSW 9 119337418 missense probably benign 0.06
R3417:Myd88 UTSW 9 119337490 missense possibly damaging 0.90
R3836:Myd88 UTSW 9 119338193 missense probably benign
R3892:Myd88 UTSW 9 119337816 missense possibly damaging 0.93
R3917:Myd88 UTSW 9 119341398 start gained unknown
R4003:Myd88 UTSW 9 119338610 missense noncoding transcript
R4081:Myd88 UTSW 9 119339987 missense unknown
R4634:Myd88 UTSW 9 119338109 nonsense probably null
R4637:Myd88 UTSW 9 119338109 nonsense probably null
R5091:Myd88 UTSW 9 119337823 missense possibly damaging 0.69
R5426:Myd88 UTSW 9 119339750 missense noncoding transcript
R5604:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
R5604_K:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
R5604_Q:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, gDNA
MMRRC Submission 010473-UCD
Last Updated 06/14/2017 10:36 AM by Katherine Timer
Record Created unknown
Record Posted 11/30/2007
Phenotypic Description
Figure 1. Peritoneal macrophages from lackadaisical (Lkd) mice treated with the TLR7 ligand resiquimod (A) and the TLR9 ligand CpG (B) produce reduced amounts of TNF when stimulated with low concentrations of ligand. Macrophages from Myd88 knockout mice are used as controls. Values represent mean ± SEM (n=6 mice or more). (C) Macrophages from WT or Lkd mice pretreated with IFN-γ (10 units/ml) then treated with TLR ligands and assayed from type I IFN. Lkd macrophages do not respond to resiquidmod or CpG, which signal through MyD88. Similar results were observed in three independent experiments. Figure reproduced from reference (1).
The lackadaisical phenotype was identified in a screen for ENU-induced mutants with altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1).  Peritoneal macrophages from lackadaisical mice produce reduced amounts of tumor necrosis factor (TNF)-α in response to resiquimod (TLR7 ligand) and unmethylated CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand).  The dose response curve ([TNF-α] versus [ligand]) for both ligands is shifted to the right, such that lackadaisical cells produce approximately the same amount of TNF-α as wild type cells when stimulated with a 10X higher ligand concentration (Figure 1). Lackadaisical macrophages display normal TNF-α responses to poly I:C (TLR3 ligand), lipopolysaccharide (LPS, TLR4 ligand), Pam3CSK4 (a triacyl lipopeptide, TLR2/1 ligand), and MALP-2 (a diacyl lipopeptide, TLR2/6 ligand).  Type I interferon production induced by either CpG ODN or resiquimod is abolished in lackadaisical macrophages (Figure 1).
 
Phosphorylation of JNK, the MAP kinase ERK, and IκB is eliminated in lackadaisical macrophages upon resiquimod stimulation.
 
When infected intraperitoneally with 5 x 105 pfu of mouse cytomegalovirus, lackadaisical mice contain the virus as efficiently as wild type mice (MCMV Susceptibility and Resistance Screen), as measured by viral titers in the spleen and type I IFN concentration in serum.

 

Nature of Mutation
The lackadaisical mutation was mapped to a region of Chromosome 9 including Myd88.  Sequencing identified an A to G transition in exon 2 (of 6 total exons) at position 428 of the Myd88 transcript.  The lackadaisical locus was confirmed to be allelic with Myd88.
 
412 GAGGACTGCCAGAAATACTTAGGTAAGCAGCAG
111 -E--D--C--Q--K--Y--L--G--K--Q--Q-
 
The mutated nucleotide is indicated in red lettering, and results in a tyrosine to cysteine change at position 116 of the MyD88 protein.
Protein Prediction
Figure 2. MyD88 is a 296 amino acid protein adapter. It contains an N-terminal death domain (DD) that acts as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins. The C-terminal portion of MyD88 contains a Toll/IL-1 receptor (TIR) domain, a conserved region which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling. Between the death domain and TIR domain is an “intermediate domain” that may be required for differential activation of distinct NF-κB- versus JNK-dependent transcriptional programs. The lackadaisical mutation results in the substitution of tyrosine with cysteine at residue 115.This image is interactive. Click on the image to view other mutations found in MyD88 (red). Click on the mutations for more specific information.
The lackadaisical mutation results in the substitution of tyrosine with cysteine at residue 115 of MyD88, which exists in the intermediate domain between the death domain and the TIR domain (Figure 2).
 
Please see the record for pococurante for information about Myd88.
Putative Mechanism
Figure 3. MyD88 signaling pathways. MyD88 is a protein adapter that relays signals from the IL-1 and IL-8 receptors (not shown) and from most TLRs. Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it recruits IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6. The signaling pathway culminates in the activation of NF-κB-dependent transcription. MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus. MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly. This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1.
The lackadaisical mutation changes a single residue in the intermediate domain of MyD88.  Alternative splicing of Myd88 results in a variant that lacks the intermediate domain (MyD88s), which is expressed only in the spleen and brain (2). When overexpressed in HEK293 cells, MyD88s is able to bind IRAK, but does not activate NF-κB (a hallmark of MyD88 signaling)(Figure 3), reportedly because MyD88s is unable to induce IRAK phosphorylation (2). The MyD88 intermediate domain has been suggested to provide for differential activation of distinct (NF-κB- versus JNK-dependent) transcriptional programs (3). MyD88s has been postulated to act as a negative regulator of MyD88-dependent NF-κB activation (3).  MyD88s expression is not detected in several cell lines of different origin, but may be induced after prolonged (16 hours) LPS treatment in a human monocytic cell line (2).  The protein encoded by Myd88lck does not act as a dominant negative inhibitor of LPS-induced (or other ligand-induced) NF-κB activation, and therefore probably does not function like MyD88s.  However, the lackadaisical phenotype supports the hypothesis that the intermediate domain is important for MyD88 function.  It appears that the lackadaisical mutation is a relatively mild loss-of-function mutation, since TLR signaling is retained at least partially (for TLRs 7 and 9), and in most cases completely (TLRs 3, 4, 2/1, 2/6), in these mutants.  In support of this conclusion, lackadaisical mice display robust resistance to MCMV infection.  On the other hand, complete loss of TLR9 function (e.g., in mice homozygous for the CpG1 allele) causes substantial impairment of MCMV resistance, despite retention of normal TLR7 signaling. The lackadaisical phenotype, as well as other studies, suggest that MyD88 is recruited to TLRs in a ligand-specific manner (1;4).  Distinct ligands likely bind distinct sites in TLR ectodomains (5), inducing unique receptor conformations intracellularly that may be recognized differentially by adapters.
Primers Primers cannot be located by automatic search.
Genotyping
Lackadaisical genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
1) lackadaisical(F): 5’- GCAGTCAGTGCTCTTACCGGCTGAG -3’
2) lackadaisical(R): 5’- AATGAGCAGCTTGCCCAAGGTCCC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:20
4) 68°C             1:00
5) repeat steps (2-4) 34X
6) 68°C             5:00
7) 4°C               ∞
 
Primers for sequencing
2) lackadaisical_seq(F): 5’- TCTTACCGGCTGAGCCATCTC -3’
1) lackadaisical_seq(R): 5’- AAGGTCCCAGGTCCATCCATC -3’
 
The following sequence of 426 nucleotides (from Genbank genomic region NC_000075 for linear genomic DNA sequence of Myd88) is amplified:
 
1165                           gcagtc agtgctctta ccggctgagc catctcgcca
1201 gccccaagta ggctctttaa actaattcag gattttgagt gtgtgtacag cagcaacctg
1261 gggcatgggg ggcgggggtg tcggggatgg ggtgggagga ggagcctcta cacccttctc
1321 ttctccacag aggaggactg ccagaaatac ttaggtaagc agcagaacca ggagtccgag
1381 aagcctttac aggtggccag agtggaaagc agtgtcccac aaacaaagga actgggaggc
1441 atcaccaccc ttgatgaccc cctaggtaag ggcccagtac tgtgccccta ggtagaatag
1501 gtgggccaca gcctcaaaca tgtgacctgc agagggcatg gataccggaa gcagatggat
1561 ggacctggga ccttgggcaa gctgctcatt
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsZhengfan Jiang, Bruce Beutler
Edit History
05/31/2011 2:48 PM (current)
05/31/2011 2:47 PM
05/31/2011 2:11 PM
05/31/2011 2:04 PM
01/07/2011 9:18 AM
07/23/2010 12:09 PM
07/13/2010 10:09 AM
07/08/2010 8:52 AM
05/25/2010 1:16 PM
05/25/2010 1:09 PM
05/25/2010 11:38 AM
05/25/2010 11:37 AM
02/25/2010 3:04 PM