Phenotypic Mutation 'wanna2' (pdf version)
Allelewanna2
Mutation Type missense
Chromosome1
Coordinate36,820,493 bp (GRCm39)
Base Change T ⇒ C (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,800,879-36,821,899 bp (+) (GRCm39)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009539; MGI: 99613

MappedYes 
Limits of the Critical Region 36761861 - 36782816 bp
Amino Acid Change Cysteine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000027291]
AlphaFold P43404
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: C563R

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000027291)
Meta Mutation Damage Score 0.9708 question?
Is this an essential gene? Probably nonessential (E-score: 0.246) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(20) : Chemically induced (ENU)(6) Gene trapped(1) Spontaneous(2) Targeted(10) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36820230 missense probably damaging 1.00
murdock APN 1 36818785 missense probably damaging 0.99
IGL00763:Zap70 APN 1 36818333 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36810238 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36817868 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36810267 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36817887 splice site probably benign
IGL02597:Zap70 APN 1 36811001 nonsense probably null
IGL03026:Zap70 APN 1 36818798 missense possibly damaging 0.94
biscayne UTSW 1 36820493 missense probably damaging 1.00
mesa_verde UTSW 1 36818254 missense probably damaging 1.00
shazzam UTSW 1 36820218 missense probably damaging 1.00
trebia UTSW 1 36820106 missense probably damaging 1.00
wanna UTSW 1 36810064 missense probably damaging 1.00
wanna3 UTSW 1 36817299 missense probably damaging 0.99
wanna4 UTSW 1 36820446 missense probably damaging 1.00
want_to UTSW 1 36821598 missense probably damaging 1.00
waterfowl UTSW 1 36809892 start codon destroyed probably null 0.03
zapatos UTSW 1 36810262 missense possibly damaging 0.89
zipper UTSW 1 36809983 missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36818250 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36818365 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36820258 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36818254 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36810036 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36818215 missense probably benign
R3623:Zap70 UTSW 1 36818216 missense probably benign 0.03
R3689:Zap70 UTSW 1 36820493 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36820493 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36810223 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36817498 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36818189 splice site probably benign
R4383:Zap70 UTSW 1 36820042 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36817539 missense probably benign
R4783:Zap70 UTSW 1 36818254 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36820532 missense probably benign 0.00
R5271:Zap70 UTSW 1 36820446 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36817299 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36818090 intron probably benign
R5932:Zap70 UTSW 1 36820227 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36810030 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36821598 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36817471 missense probably damaging 1.00
R7039:Zap70 UTSW 1 36817832 missense probably benign
R7704:Zap70 UTSW 1 36818395 critical splice donor site probably null
R7769:Zap70 UTSW 1 36809983 missense probably benign 0.09
R8115:Zap70 UTSW 1 36820287 missense probably damaging 1.00
R8140:Zap70 UTSW 1 36810262 missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36820218 missense probably damaging 1.00
R9186:Zap70 UTSW 1 36818832 missense possibly damaging 0.66
R9540:Zap70 UTSW 1 36817869 missense possibly damaging 0.95
R9654:Zap70 UTSW 1 36818327 missense probably benign 0.03
R9674:Zap70 UTSW 1 36810150 missense probably benign 0.10
S24628:Zap70 UTSW 1 36809892 start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36818257 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038234-MU
Last Updated 2019-09-04 9:44 PM by Diantha La Vine
Record Created 2015-09-18 10:31 PM by Jin Huk Choi
Record Posted 2015-10-09
Phenotypic Description

Figure 1. Homozygous wanna2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The wanna2 phenotype was identified among G3 mice of the pedigree R3689, one of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the diminished T-dependent antibody response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R3689.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. The diminished T-dependent antibody response to rSFV-β-gal phenotype was linked by continuous variable mapping to a mutation in Zap70:  a T to C transition at base pair 36,781,412 (v38) on chromosome 1, or base pair 19,615 in the GenBank genomic region NC_000067.  Linkage was found with a recessive model of inheritance (P = 7.764 x 10-6), wherein one variant homozygote departed phenotypically from three homozygous reference mice and 10 heterozygous mice (Figure 2).  

The mutation corresponds to residue 1,849 in the mRNA sequence NM_001289766 within exon 12 of 13 total exons.


 

19600 GAATGTCCGCCGGAGTGTCCTCCTGAGATGTAT

558   -E--C--P--P--E--C--P--P--E--M--Y-

Genomic numbering corresponds to NC_000067. The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to arginine (R) substitution at residue 563 (C563R) in the ZAP70 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999) (1).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The wanna2 mutation causes a cysteine (C) to arginine (R) substitution at amino acid 563 (C563R). The 3D structure is human ZAP70. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Other mutations found in ZAP-70 are noted in red. Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The ζ-associated protein of 70 kDa (ZAP-70) is a protein tyrosine kinase (PTK) that binds to the doubly phosphorylated immunoreceptor tyrosine-based activation motifs (ITAMS) of ζ and CD3ε chains of the T cell receptor (TCR; see the record for tumormouse). ZAP70 consists of two N-terminal Src-homology 2 (SH2) domains at amino acids and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A, while the region between the second SH2 and catalytic domains is known as interdomain B (2). The two SH2 domains of mouse ZAP-70 occur at amino acids 10-102 and 163-254, and work cooperatively to bind to the phosphorylated tyrosines of an ITAM sequence [(D/E)xxYxxI/Lx(6-8)YxxI/L]. The wanna2 mutation results in a cysteine (C) to arginine (R) substitution at 563 within the ZAP70 kinase domain (Figure 3).

Please see the record for murdock for more information about Zap70.

Putative Mechanism

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (3;4)]. Syk and ZAP-70 function as critical mediators of pre-TCR and TCR signaling, with ZAP-70 having a predominant role in mature T cells (4;5). Once activated, ZAP-70 and Syk interact with and phosphorylate a number of substrates important for TCR signaling including the adaptor proteins the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6;7). Once phosphorylated, these two adaptors serve as docking sites and organize a number of effector molecules into the correct spatiotemporal manner to allow the activation of multiple signaling pathways. Zap70 knockout mice display an arrest of T cell development at the DP stage, the second critical checkpoint important during αβ T cell development due to defective TCR-mediated selection and signaling at this stage (5;8). Although ZAP-70 has a critical role in T cell development and function, it also plays a role downstream of the BCR and in NK cells. Zap70 knockout mice display normal B cell development, mount normal antibody responses and also proliferate appropriately to various stimuli (9)

The wanna2 mice exhibit a similar phenotype to the wanna mice, which exhibit an ENU-induced mutation in Zap70. The phenotype of the wanna2 mouse provides in vivo confirmation that Cys 563 is important for ZAP70 function.

Primers PCR Primer
wanna2_pcr_F: CCTTCTCCTATGGCCAGAAG
wanna2_pcr_R: TGTTGGGAAGCCAAGCACAG

Sequencing Primer
wanna2_seq_F: GCCAGAAGCCCTACAAGGTAG
wanna2_seq_R: AAGAAGCCGGGTGTGACTCTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 1, + strand):


1   ccttctccta tggccagaag ccctacaagg taggctgggc agtttggcaa cggtgggctg
61  gggaggtgga ccctggctcc tcacacacga atgcctttgt ccctggcctg agcagaaaat
121 gaagggcccc gaggtcctgg acttcatcaa gcagggtaag aggatggaat gtccgccgga
181 gtgtcctcct gagatgtatg cacttatgag tgactgctgg atctacaagt gagttccagg
241 ggggcggggg gggggggcgg ggatgtggcc gtacagccct gagcctagcg aggatctcct
301 caagcccagg cagcgctacc tttaccctta gtattccact cacagagtca cacccggctt
361 cttcctttaa tctgtcccca tctgtgcttg gcttcccaac a


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJin Huk Choi, James Butler, Bruce Beutler