Phenotypic Mutation 'invisible' (pdf version)
List |< first << previous [record 12 of 18] next >> last >|
Alleleinvisible
Mutation Type splice donor site (4 bp from exon)
Chromosome7
Coordinate128,070,703 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Itgam
Gene Name integrin alpha M
Synonym(s) Mac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3
Chromosomal Location 128,062,640-128,118,491 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001082960 (variant 1), NM_008401; MGI:96607

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000068468] [ENSMUSP00000095625] [ENSMUSP00000101847] [ENSMUSP00000101849] [ENSMUSP00000113957] [ENSMUSP00000121676]
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000113412
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:3K72|C 17 79 2e-17 PDB
SCOP:d1m1xa4 17 81 6e-18 SMART
Blast:Int_alpha 30 79 5e-29 BLAST
Predicted Effect noncoding transcript
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000121676
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:3K72|C 17 79 2e-17 PDB
SCOP:d1m1xa4 17 81 9e-18 SMART
Blast:Int_alpha 30 79 3e-29 BLAST
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD11b+ DCs (gated in CD11c+ cells) - decreased
FACS CD8a+ DCs (gated in CD11c+ cells) - increased
FACS macrophages - decreased
FACS neutrophils - decreased
FACS pDCs - increased
Penetrance  
Alleles Listed at MGI

All mutations/alleles(5) : Gene trapped(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Itgam APN 7 128085661 missense probably damaging 1.00
IGL00983:Itgam APN 7 128068667 missense probably damaging 0.97
IGL01102:Itgam APN 7 128080273 missense possibly damaging 0.94
IGL01615:Itgam APN 7 128116767 missense possibly damaging 0.80
IGL01845:Itgam APN 7 128112472 missense probably damaging 1.00
IGL01860:Itgam APN 7 128070943 missense probably benign 0.03
IGL01874:Itgam APN 7 128115166 missense probably damaging 0.97
IGL01910:Itgam APN 7 128083776 missense probably damaging 1.00
IGL01994:Itgam APN 7 128101727 missense probably damaging 0.97
IGL02332:Itgam APN 7 128085674 critical splice donor site probably null
IGL02348:Itgam APN 7 128116300 missense possibly damaging 0.52
IGL02394:Itgam APN 7 128084942 missense probably benign 0.01
IGL02491:Itgam APN 7 128116018 missense possibly damaging 0.71
IGL02695:Itgam APN 7 128085941 missense possibly damaging 0.81
IGL02821:Itgam APN 7 128076109 missense probably damaging 0.99
IGL02970:Itgam APN 7 128086043 missense probably benign 0.00
IGL03145:Itgam APN 7 128113019 missense probably benign 0.12
R0184:Itgam UTSW 7 128086058 missense probably damaging 0.96
R0389:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0443:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0454:Itgam UTSW 7 128107980 missense probably benign 0.01
R0674:Itgam UTSW 7 128116218 missense possibly damaging 0.67
R0828:Itgam UTSW 7 128116505 critical splice donor site probably null
R0925:Itgam UTSW 7 128112238 missense probably benign 0.00
R1086:Itgam UTSW 7 128080264 missense probably damaging 1.00
R1655:Itgam UTSW 7 128115163 missense probably benign 0.00
R1809:Itgam UTSW 7 128070937 missense possibly damaging 0.62
R1823:Itgam UTSW 7 128064732 missense probably benign 0.04
R2105:Itgam UTSW 7 128081712 missense probably damaging 1.00
R2154:Itgam UTSW 7 128085577 missense probably damaging 0.99
R2656:Itgam UTSW 7 128116815 unclassified probably null
R2913:Itgam UTSW 7 128112406 missense probably damaging 1.00
R3116:Itgam UTSW 7 128116029 missense probably damaging 1.00
R3404:Itgam UTSW 7 128070703 unclassified probably null
R3821:Itgam UTSW 7 128112286 splice site probably null
R3822:Itgam UTSW 7 128112286 splice site probably null
R3960:Itgam UTSW 7 128115175 missense probably benign 0.02
R3968:Itgam UTSW 7 128113033 missense probably damaging 1.00
R4192:Itgam UTSW 7 128064732 missense probably benign 0.21
R4400:Itgam UTSW 7 128081658 missense probably damaging 1.00
R4708:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4709:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4742:Itgam UTSW 7 128113073 missense probably damaging 1.00
R4790:Itgam UTSW 7 128116273 missense probably benign 0.01
R4960:Itgam UTSW 7 128115840 missense possibly damaging 0.93
R5109:Itgam UTSW 7 128113218 missense probably benign 0.06
R5190:Itgam UTSW 7 128116317 unclassified probably null
R5379:Itgam UTSW 7 128112388 missense probably damaging 1.00
R5386:Itgam UTSW 7 128107980 missense probably benign 0.00
R6104:Itgam UTSW 7 128116302 missense possibly damaging 0.85
R6122:Itgam UTSW 7 128085652 missense probably damaging 0.99
R6189:Itgam UTSW 7 128112504 missense probably benign 0.04
R6282:Itgam UTSW 7 128084942 missense probably benign 0.01
R6545:Itgam UTSW 7 128107872 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038236-MU
Last Updated 2016-10-27 3:06 PM by Anne Murray
Record Created 2015-10-03 2:54 PM by Bruce Beutler
Record Posted 2016-10-27
Phenotypic Description

Figure 1. Invisible mice exhibit decreased frequencies of peripheral CD11b+ dendritic cells (DCs) gated in CD11c+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Invisible mice exhibit increased frequencies of peripheral CD8a+ DCs gated in CD11c+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Invisible mice exhibit increased frequencies of plasmacytoid DCs. Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Invisible mice exhibit reduced frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Invisible mice exhibit reduced frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The invisible phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3404, some of which showed a reduced frequency of CD11b+ dendritic cells (DCs) gated in CD11c+ cells (Figure 1), an increased frequency of CD8a+ DCs gated in CD11c+ cells (Figure 2), an increased frequency of plasmacytoid DCs (pDCs) (Figure 3), a reduced frequency of macrophages (Figure 4), and a reduced frequency of neutrophils (Figure 5), all in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of the reduced frequency of peripheral blood CD11b+ DCs using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R3404. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Itgam:  an A to G transition at base pair 128,070,703 (v38) on chromosome 7, or base pair 8,064 in the GenBank genomic region NC_000073, within the donor splice site of intron 4 (four base pairs from exon 4). The strongest association was found with a recessive model of linkage to the normalized frequency of CD11b+ DCs, wherein five variant homozygotes departed phenotypically from nine homozygous reference mice and 18 heterozygous mice with a P value of 8.807 x 10-31 (Figure 6). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 71-base pair exon 4 (out of 30 total exons), resulting in a frame-shift after amino acid 79 and coding of 46 aberrant amino acids followed by a premature stop codon within exon 6 (after amino acid 125).

 
              <--exon 3         <--exon 4 intron 4-->         exon 5-->
6042 ……CCCATCCCCCTGCAAG ……CCCCAGCAGCTGCTG gtgagttgccctccaaa…… GCCTGTGGCCC……GCAGGAGAGTGA…… 13414
75   ……-P--I--P--L--Q-- ……-P--Q--Q--L--L-                     G--L--W--P-……-A--G--E--*    125

           correct            deleted                                 aberrant

 

Genomic numbering corresponds to NC_000073. The donor splice site of intron 4, which is destroyed by the invisible mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 7. Domain organization of CD11b. The location of the invisible mutation is shown. The locations of the β-propeller domain repeats and I domain are indicated. Abbreviations: SP, signal peptide; TM, transmembrane domain.
Figure 8. 3D structure of the extracellular segment of integrin αVβ3. The crystallized form folds back at an angle of 135°, forming a V-shaped structure that represents the latent, low-affinity state. αV forms a seven-bladed β-propeller containing the I-domain, followed by three β-sandwhich domains: an Ig-like "thigh" domain and two similar domains that form the "calf" module. The I-like domain of β3 interacts with the β-propeller of αV., and is followed by the hybrid domain formed from segments on either side of the I-like domain, four EGF domains and a β-tail domain (βTD). UCSF Chimera model is based on PDB 1JV2. Click on the structure to view it rotate.

Itgam encodes CD11b, a surface marker on myeloid dendritic cells that regulates leukocyte adhesion and migration as well as phagocytosis and cytotoxicity. CD11b is an integrin α protein that forms a noncovalently linked dimer with the integrin β2 protein (also called CD18; see the record for Joker) to form functional integrin receptors.

 

CD11b is a single-pass transmembrane domain with an extracellular N-terminus (amino acids 17-1105) and a cytoplasmic C-terminus (amino acids 1130-1153) (Figure 7) (1). Amino acids 1-16 comprise a signal peptide. Electron microscopy determined that the integrin receptor extracellular domain is a globular ligand-binding headpiece connected to two long stalk regions, which is then connected to the transmembrane and C-terminal cytoplasmic domains. Electron microscopic studies, crystallographic and NMR analyses strongly suggest that integrin ectodomains exist in a bent conformation in the latent, low-affinity state (Figure 8; PDB 1JV2) (2-4). Destabilization of the interface between the α and β legs in the tailpiece leads to destabilization of the bent conformation and “switchblade-like” opening of the structure to an open high-affinity conformation where ligand may bind. On the cell surface, integrins equilibrate between the low- and high-affinity state, an equilibrium which may be shifted by the presence of intracellular activators or extracellular ligands (4). The extracellular domain of CD11b has several subdomains, including seven β-propeller repeats that form a β-propeller fold, and a Von Willebrand factor (alternatively integrin I-domain; amino acids 148-333) domain. The I-domain serves as a binding site for several of the CD11b ligands (5) (see the Background section). It has six major α helices and a β sheet composed of five parallel and one anti-parallel β strand. There is a large interface between the β-propeller domain of the integrin α subunit (containing the I domain) and the I-like domain of the integrin β subunit (2). Evidence suggests that the I-like domain regulates the conformation of the I domain when both are present in the integrin (6). Ligand binding depends on the integrity of the metal ion-dependent adhesion site (MIDAS) in both the I and I-like domains. The MIDAS binds to divalent cations and coordinates with a glutamine or aspartate residue in the ligand. Please refer to reference (5) for an excellent review of integrin receptor extracellular domains and structure.

 

CD11b undergoes several posttranslational modifications. Three regions of CD11b mediate calcium binding: amino acids 465-473, 529-537, and 592-600. There are 19 putative N-glycosylation sites within the extracellular domain. Phosphorylation of Ser1126 in the cytoplasmic domain regulates CD11b activation (7). Mutation of Ser1126 prevents the activation of CD11b upon binding to its ligands ICAM-1 and ICAM-2; activation of CD11b by another ligand, iC3b, was not affected. The extracellular domain of CD11b is cleaved by serine proteases including elastase, proteinase-3, and cathepsin G, which mediates neutrophil detachment from the surface of epithelial monolayers before neutrophil transmigration (8). The cleavage site for elastase/proteinase-3 is 761Thr-Ala762, while the cathepsin G cleavage site is 760Phe-Thr761 (8).

 

 The mutation in invisible putatively results in a in a frame-shift and coding of a premature stop codon within exon 6 (corresponding to amino acid 125). Amino acid 125 is within the CD11b extracellular domain within an undefined region between the first β-propeller repeat and the I domain.

Expression/Localization

CD11b/CD18 is expressed on macrophages, neutrophils, dendritic cells (DCs), peritoneal cavity mast cells, and peritoneal cavity B1 cells (9;10). However, almost half of the cells in the B1a or B1b subset do not express CD11b. CD11b expression is upregulated during myelomonocytic cell line differentiation and maturation (1). However, blood monocyte differentiation into macrophages results in downregulation of CD11b on the cell surface (11). CD11b expression is upregulated on NK cells upon NK cell maturation and activation (12). CD11b expression on the surface of neutrophils and monocytes is upregulated by inflammatory stimuli.

Background
Figure 8. Activation and signaling of integrin receptors. Left, Schematic of open, high-affinity conformation of an integrin receptor consisting of α and β integrin subunits. The I domain of the α subunit typically contains the ligand-binding site of the integrin, and its conformation is regulated by the β subunit I-like domain to which it binds directly. Center, Inside-out signaling, also called priming, occurs when intracellular proteins such as talin bind to the tails of β integrins, clustering the receptors at the cell membrane and thereby increasing avidity for ligand. (Kindlin-1 and Kindlin-2 proteins have also been found to interact with and activate integrins from inside the cell.) Right, Integrin ligands, also known as counter-receptors, activate integrins during outside-in signaling and induce clustering that permits the recruitment of signaling molecules to the cytoplasmic face of the receptor.

Integrins are adhesion molecules that mediate cell-cell, cell-extracellular matrix, and cell-pathogen interactions. They regulate cell migration and morphogenesis by coordinating regulatory signals from inside and outside the cell, with the physical machinery for cell movement. Most integrins, including β2-integrins, link to and regulate the actin cytoskeleton. Their ligands are diverse, but most possess a short peptide motif containing an acidic residue (aspartate or glutamate) positioned in a flexible loop. There are 24 distinct integrins formed by a combination of α and β subunits, and those containing the β2 subunit are leukocyte-specific [reviewed in (13)]. Each leukocyte class expresses a distinct pattern of integrins that changes in functional state, density and localization in response to intra- and extracellular cues, including protein modifications (e.g. phosphorylation), cytokines, chemokines, and other cell adhesion molecules. However, all leukocytes express one or more β2-containing integrin. The β2-containing integrins are αLβ2 (CD11a/CD18; also called leukocyte function-associated antigen 1, LFA-1), αMβ2 (CD11b/CD18; also called MAC-1 or complement receptor 3 [CR3]), αXβ2 (CD11c/CD18; also called p150,95 or CR4) and αDβ2 (CD11d/CD18). The CD11/CD18 integrins are referenced collectively as the “leukocyte” integrins, and mediate leukocyte adhesion during inflammatory responses to infections and also during wound repair.

 

Leukocytes circulate in the blood in a quiescent state of low adhesiveness, becoming activated and migrating into tissues during microbial invasion in order to defend against infection. The β2-containing integrins are thus inactive when leukocytes are in a resting state, and must be rapidly activated during infection to mediate leukocyte adhesion to various cell types such as endothelial cells of vessel walls and antigen-presenting cells. Integrins transmit signals bidirectionally across the plasma membrane. “Outside-in” signaling occurs when ligands bind to integrins, and serves to mediate adhesion and to initiate downstream signaling (Figure 9). Ligand binding induces the clustering of integrins on the cell surface and enables the recruitment of signaling molecules to the cytoplasmic face of the receptor.

 

“Inside-out” signaling primes integrins for ligand binding. The adhesive state of integrins may be modulated by conformational changes in the integrin itself, or possibly by clustering of integrins on the cell surface to increase avidity (5). The intracellular domain of the β2 chain has been shown to influence integrin adhesive activity in the case of LFA-1 (14;15). How this process is regulated is largely unknown, but Rho family GTPases and the cytoskeletal protein talin have been shown to play a role. Knockdown of the leukocyte-specific inhibitory RhoH in peripheral blood lymphocytes results in a constitutively adherent phenotype towards ICAM-1, demonstrating that RhoH promotes the nonadhesive state of LFA-1 (integrin αLβ2) (16). Conversely, knockdown of talin impairs TCR-induced adhesion to ICAM-1 (17). Another Rho GTPase, RhoA, promotes neutrophil adhesion through β2 integrin (18).

 

Dendritic cells sense and subsequently present antigens to T cells to induce an antigen-specific immune response. DCs resident in lymphoid tissue are termed conventional DCs (cDCs), which can be subdivided into two subsets, CD8α+ DCs and CD4+CD11b+ DCs. Migratory DCs express the integrins CD103 or CD11b, except in the lamina propria where DCs can co-express both CD103 and CD11b (19;20). CD11b+ DCs have several known functions. For example, splenic CD11b+ DCs induce CD4+ T cell proliferation (21). Dermal CD11b+ DCs are essential for the induction of efficient CD8+ memory T cell responses (22). Lung CD11b+ DCs induce Th2 responses in response to house dust mite, a model of allergic inflammation (23). After Aspergillus fumigatus infection, lung CD11b+ DCs stimulate T helper 17 (Th17) immunity through the release of IL-23 (24). Intestinal CD11b+ DCs also control Th17 immunity. Intestinal CD11b+ DCs are separated into two subsets according to the expression of CD103. CD11b+CD103+ DCs regulate intestinal homeostasis and also are the major producers of Th17-inducing cytokines after Citrobacter rodentium infection or after exposure to TLR5 ligand (25-26). CD11b+CD103- DCs are a small population, and migrate to the mesenteric lymph node where they induce IFN-γ/IL-17-secreting CD4+ T-cells (27).

 

The CD11b/CD18 integrin has several functions; the ligands that mediate these functions are summarized in Table 1:

  1. CD11b/CD18 inhibits DC maturation and function as well as DC-induced T cell activation (28;29).
  2. CD11b/CD18 mediates the phagocytosis of iC3b-coated particles (e.g., apoptotic cells) (30).
  3. CD11b/CD18 mediates chemotaxis by binding ICAM ligands on blood vessel endothelium (7;31).
  4. is required for monocyte activation through the stimulation of several signaling pathways including the NF-κB (see the record for Finlay) and the TNF (see the record for Panr1) pathways resulting in the subsequent induction of cytokines, chemokines, and transcription factors (32).
  5. promotes osteoclast differentiation in the bone marrow and circulation upon RANKL induction (33).
  6. CD11b/CD18 functions in the development of antigen-induced immune tolerance partly through the suppression of Th17 differentiation (34). In Itgam-deficient (Itgam-/-) mice, increased IL-6 production of antigen presenting cells promoted the preferential differentiation of naïve T cells to Th17 cells. Immunization of the Itgam-/- mice resulted in IL-17 production within the lymph nodes, which interfered with the establishment of oral tolerance.
  7. CD11b/CD18 recognizes extracellular dsRNA to induce macrophage immune responses (35). In peritoneal macrophages and serum, Itgam deficiency led to diminished poly(I:C)-induced inflammatory cytokine induction. CD11b interacts with poly(I:C) on the macrophage surface. Upon recognition of dsRNA by CD11b/CD18, the poly(I:C) is internalized through PI3K signaling induction and -associated activation of interferon regulatory factor 3 (IRF3) in macrophages. In addition, poly(I:C) induced NADPH oxidase (NOX2) activation in a TLR3-independent, CD11b/CD18-dependent manner. The NOX2-derived reactive oxygen species subsequently activated MAPK
  8. CD11b/CD18 mediates the efflux of activated macrophages to the lymphatics and is proposed to assist in the removal of local inflammatory macrophages and in their subsequent migration to the lymph nodes or back to the circulation (36). CD11b/CD18 is not required for early monocyte accumulation or the reduction within the peritoneum. However, CD11b/CD18 is required for the accelerated migration of activated macrophages from the peritoneum to the lymphatics.
  9. Nearly half of B1a and B1b cells in the peritoneal cavity express CD11b (10). The CD11b+ B1 cells are larger and more granular than B1 cells that do not express Cd11b (often referred to B1c cells (37)). In addition, the CD11b+ B1 cells express more surface IgM and less surface IgD than the CD11b- B1 cells. The CD11b+ B1 cells form tightly associated doublets, which are observed at a high frequency in the peritoneal cavity; the function of the doublets is unknown. The CD11b+ B1 cells had a limited reconstitution capability.
  10. CD11b negatively regulates NK cell activation. Treatment with an anti-CD11b antibody increased NK cell cytotoxicity and interferon-γ (IFN-γ) and granzyme B production (12). Itgam-deficient NK cells stimulated with poly(I:C) showed more potent cytotoxicity, and higher production of IFN-γ and granzyme B.
  11. CD11b/CD18 restricts TLR signaling in macrophages through the Src/Syk (see the record for poppy) signaling pathway and subsequently leads to the degradation of MyD88 (see the record for pococurante) and TRIF (see the record for Lps2) (38). CD11b/CD18 reduces macrophage responses by inducing signaling inhibitors such as suppressor of cytokine signaling 3 (SOCS3) and A20 as well as IL-10 (39).

 

Table 1. CD11b/CD18 (αMβ2, MAC-1) ligands

Ligand

Brief Description

Effect

References

ICAM-1

Ig superfamily cell adhesion molecule

Leukocyte adhesion and emigration

(40;41)

ICAM-2

(42)

ICAM-4

(43)

iC3b

Complement fragment

Cell adhesion and phagocytosis

(44)

Fibrinogen

Provisional matrix molecule; blood coagulation protein

Binding of polymorphonuclear leukocytes to fibrinogen-coated surfaces

(45)

Heparin

Clotting factor

Mediates firm adhesions between neutrophils and E-selectin

(46)

Low-density lipoprotein receptor related protein (LRP)

Cell surface receptor (see the record for r18)

Mediates leukocyte adhesion

(47)

Matrix metalloproteinase 9 (MMP9)

Membrane-type metalloproteinase

Regulates cell motility

(48)

Factor X

Clotting factor

Stimulates rapid fibrin formation

(49)

CD40L/CD40

See the record for walla; provides costimulatory, activating signals to antigen presenting cells (APCs) such as B cells, macrophages, and dendritic cells (DCs)

Mediates leukocyte recruitment

(50)

 

Neutrophils from Itgam-deficient (Itgam-/-) mice exhibit defective adherence to fibrinogen, iC3b-mediated phagocytosis, and homotypic aggregation as well as reduced degranulation (51;52). Neutrophil accumulation in the peritoneal cavity of thioglycolate challenged Itgam-/- mice was normal (52). Blood leukocyte and peripheral blood neutrophil counts in the Itgam-/- mice were comparable to that in wild-type mice (51). The ability of neutrophils to roll as well as the velocity of rolling cells was normal in the Itgam-/- mice (51). Intraperitoneal injection of thioglycollate, an inducer of neutrophil-rich inflammatory exudate, resulted in an accumulation of neutrophils in the peritoneal exudate (51). Apoptosis of the extravasated neutrophils was decreased in the Itgam-/- mice compared to that in wild-type mice (51). In addition, eosinophil accumulation after thioglycolate injection in the Itgam-/- mice was higher than that in wild-type mice. T cells from the Itgam-/- mice exhibited diminished CD3 and CD28 expression and the Itgam-/- mice had a reduced CD4/CD8 ratio due to a diminished frequency of CD4+ T cells. Splenocytes from Itgam-/- mice exhibited diminished T cell responses to stimulation with staphylococcal enterotoxin (53). Itgam-/- splenocytes exhibited reduced activation when stimulated with the leptins PHA and Con A. In contrast, when stimulated with PMA-ionomycin, the proliferative response was normal in the Itgam-/- splenocytes compared to that in wild-type mice. After transient focal cerebral ischemia, Itgam-/- mice had a reduction in infarction volume compared to wild-type mice (54). In addition, neutrophil infiltration and cerebral cell death were reduced in the Itgam-/- mice after transient focal cerebral ischemia (54). Itgam-/- mice exhibited delayed wound healing (55). However, macrophage recruitment to the wound site as well as vascularity, collage organization, or polymorphonuclear neutrophil recruitment was not impaired in the Itgam-/- mice. Itgam-/- mice have a reduced frequency of mast cells in the peritoneal cavity, peritoneal wall, and dorsal skin (9). After cecal ligation and puncture, a model of acute septic peritonitis whereby host resistance is mast cell-dependent, Itgam-/- mice exhibit increased mortality compared to wild-type mice (9).

 

Mutations in ITGAM (e.g., rs1143679, R77H) are linked to systemic lupus erythematosus (SLE) (56;57). The R77H variant affects the ability of the integrin to mediate cell adhesion to ligands. The R77H variant also exhibits aberrant phagocytosis. In addition, it does not restrict macrophage inflammatory cytokine (i.e., IL-6) production. The R77H mutation is predicted to cause SLE because of reduced clearance of apoptotic cells, leading to the activation of DCs, inflammatory cytokine production, and the uptake and presentation of nuclear antigens to T cells (58). Humans with absent or reduced levels of integrin β2 on the surface of leukocytes develop leukocyte adhesion deficiency, type I (LAD, OMIM #116920), an autosomal recessive disorder characterized by leukocytosis (especially neutrophilia), failure to recruit leukocytes to sites of infection, recurring bacterial and fungal infections involving the skin and mucosa, impaired wound healing, and lack of pus formation. Patients also show a delayed separation of the umbilical cord at birth. These deficiencies are due to impaired adhesive function and signaling of leukocytes. LAD is associated with the lack of LFA-1, MAC-1, αXβ2, but not αDβ2. The severity of the disease corresponds to the levels of functional β2-containing integrins expressed on the cell surface; most patients with no detectable CD18 expression die within the first 5 years of life unless treated by bone marrow transplantation (59).

Putative Mechanism

Similar to Itgam-/- mice, the invisible mice did not exhibit overt changes in peripheral blood leukocyte counts. The reduced frequency of CD11b+ DCs is consistent with loss of Itgam expression.

Primers PCR Primer
invisible(F):5'- CACTGCCACTTCAAATAGTTCC -3'
invisible(R):5'- TGGAGCCGAACAAATAGCAC -3'

Sequencing Primer
invisible_seq(F):5'- ATAGGACTCCATTGCGTAGACTGC -3'
invisible_seq(R):5'- CATAAGTATTCTCCTTGCAGTTTTGG -3'
Genotyping

 

References

Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsZue Zhong, Ming Zeng, Bruce Beutler
List |< first << previous [record 12 of 18] next >> last >|