Phenotypic Mutation 'curlyfry' (pdf version)
List |< first << previous [record 98 of 511] next >> last >|
Allelecurlyfry
Mutation Type critical splice acceptor site
Chromosome1
Coordinate160,959,399 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Rc3h1
Gene Name RING CCCH (C3H) domains 1
Synonym(s) roquin, 5730557L09Rik
Chromosomal Location 160,906,418-160,974,978 bp (+)
MGI Phenotype A single recessive mutation on this gene resulted in severe autoimmune disease with phenotype resembling human systemic lupus erythematosus.
Accession Number

NCBI RefSeq: NM_027902; MGI:1919003

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
SMART Domains Protein: ENSMUSP00000037178
Gene: ENSMUSG00000040423

DomainStartEndE-ValueType
RING 14 53 5.9e-8 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 1.4e-4 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000124871
Gene: ENSMUSG00000040423

DomainStartEndE-ValueType
RING 14 53 1.25e-5 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 5.3e-7 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 1003 1011 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category decrease in body weight, growth/size, limbs/digits/tail phenotype
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(12) : Chemically induced (ENU)(3) Gene trapped(2) Radiation induced(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
sanroque APN 1 160940830 missense probably damaging 1.00
IGL00417:Rc3h1 APN 1 160955981 critical splice donor site probably null 0.00
IGL02302:Rc3h1 APN 1 160938105 splice site 0.00
IGL03053:Rc3h1 APN 1 160955817 missense probably benign 0.00
IGL03275:Rc3h1 APN 1 160959555 splice site 0.00
R0528:Rc3h1 UTSW 1 160967658 missense probably damaging 1.00
R0609:Rc3h1 UTSW 1 160930135 missense probably damaging 1.00
R1620:Rc3h1 UTSW 1 160954973 missense probably benign 0.01
R1661:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R1665:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R2027:Rc3h1 UTSW 1 160954937 missense probably benign 0.02
R2145:Rc3h1 UTSW 1 160930257 missense probably damaging 0.99
R2207:Rc3h1 UTSW 1 160940025 missense probably benign 0.05
R2227:Rc3h1 UTSW 1 160963542 missense probably benign 0.03
R2348:Rc3h1 UTSW 1 160950860 missense probably damaging 0.98
R2925:Rc3h1 UTSW 1 160954976 missense probably damaging 1.00
R3977:Rc3h1 UTSW 1 160959399 critical splice acceptor site probably null
R5071:Rc3h1 UTSW 1 160959477 missense possibly damaging 0.76
R5177:Rc3h1 UTSW 1 160951652 missense probably damaging 1.00
R5410:Rc3h1 UTSW 1 160964963 missense possibly damaging 0.47
R5421:Rc3h1 UTSW 1 160951830 missense probably null
R5699:Rc3h1 UTSW 1 160930253 missense probably damaging 1.00
R5873:Rc3h1 UTSW 1 160959501 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 10/13/2015 2:36 PM by Danielle White
Record Posted 01/20/2016
Phenotypic Description
Figure 1. The curlyfry phenotype.
Figure 2. Curlyfry mice exhibit reduced body weights compared to wild-type (REF) mice. Scaled body weights are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The curlyfry phenotype was identified among G3 mice of the pedigree R3977, some of which showed curly tails (Figure 1) and reduced body weights compared to their wild type littermates (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 52 mutations (X-axis) identified in the G1 male of pedigree R3977. Weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. The tail and body weight phenotype were linked to two genes on chromosome 1: Tnr and Rc3h1. The mutation in Rc3h1 is presumed to be causative because the curly tail and body weight phenotype mimics other known alleles of Rc3h1 [see MGI for a list of Rc3h1 alleles and (1)]. The mutation in Rc3h1 is an A to G transition at base pair 160,959,399 (v38) on chromosome 1, or base pair 52,989 in the GenBank genomic region NC_000067 encoding the Rc3h1 gene. The strongest association was found with a recessive model of linkage to the body weight phenotype, wherein seven variant homozygotes departed phenotypically from 21 homozygous reference mice and 25 heterozygous mice with a P value of 4.935 x 10-10 (Figure 3). A substantial semidominant effect was observed in the body weight assay, but the mutation is preponderantly recessive. The mutation is located within the acceptor splice site of intron 13, two nucleotides from exon 14. The effect of the mutation at the mRNA and protein level is unknown. One possibility, is that a cryptic site in intron 13 may be used, resulting in a 28-base pair insertion of intron 13. The insertion would cause a frame-shift (affecting the protein after amino acid 788) and subsequent premature termination after the inclusion of 12 aberrant amino acids. 

 

             <--exon 13         <--intron 13 exon 14-->               <--exon 20
49555 ……TTCCATCCAGAGGAA ……tattttccccctctatag TTTTTGGATGAAGAC…… ……AATTCTGCTCCCTAG…… 61387
784   ……-F--H--P--E--E-                      -F--L--D--E--D-…… ……-N--S--A--P--*-   1130
                                         correct

 

             <--exon 13                   <--intron 13 exon 14-->                 

49555 ……TTCCATCCAGAGGAA ……acccatttcctattttccccctctatgg TTTTTGGATGA…… 53001
784   ……-F--H--P--E--E- ……-T--H--F--L--F--S--P--S--M-- V--F--G--*-   800                 
           correct                      aberrant
 
Genomic numbering corresponds to NC_000067. The acceptor splice site of intron 13, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.
Protein Prediction

Figure 4. Roquin-1 functional domains. The location of the curlyfry mutation is indicated. Abbreviations: CC, coiled-coil; RING1, E3 ubiquitin ligase zinc finger domain; ROQ, novel ROQ domain; CCCH, RNA-binding zinc finger.

Rc3h1 encodes the highly conserved 1,130-amino acid intracellular Roquin-1 protein. The protein contains several domains (Figure 4), including an N-terminal RING-1 zinc finger at residues 14-53, a highly conserved novel protein domain (ROQ domain) at amino acids 131-360, a CCCH-type zinc finger domain at residues 419-438, a proline-rich region at amino acids 533-786, and a coiled-coil domain at amino acids 954-981 (1).

 

The curlyfry mutation affects the acceptor splice site of intron 13 and is predicted to lead to inclusion of 12 aberrant amino acids followed by a premature stop codon after amino acid 800. Amino acid 800 is C-terminal to the proline-rich region.

 

For more information about Rc3h1, please see the record for sanroque.

Putative Mechanism

Roquin-1 has a RING finger zinc domain typical of the E3 ubiquitin ligase family. RING finger proteins covalently attach ubiquitin to a lysine on target proteins via an isopeptide bond (2). It is possible that Roquin-1 may function as an E3 ubiquitin ligase, but its targets remain unknown. Roquin-1 is critical for negatively regulating ICOS expression and appears to do so post-transcriptionally by mediating Icos mRNA degradation (3). B cells interact with TFH through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand, CD28 with B7 ligands, and ICOS with ICOS ligand (ICOSL). This interaction results in the secretion by TFH cells of cytokines particularly IL-10 and IL-21, which are known to promote B cell survival, proliferation, and antibody production (4;5). IL-21 is also critical for the formation of TFH cells after immunization (3;6)

 

Rc3h1-deficient (Rc3h1-/-) mice exhibit perinatal lethality as well as a curly tail and malformations of the caudal spinal column, indicative of delayed or abnormal neural tube closure (7). The perinatal lethality was proposed to be due to impaired lung function (7). Rc3h1-/- mice exhibit reduced postnatal body weights from 14 to 55 weeks of age (8). The curlyfry mice exhibit curly tails and reduced body weights similar to Rc3h1-/- mice, indicating loss of Roquin-1 function. Other immune-related phenotypes observed in the sanroque mice (1) (e.g., the production of antinuclear autoantibodies, focal proliferative glomerulonephritis, necrotizing hepatitis, anemia, autoimmune thrombocytopenia, lymphadenopathy, and splenomegaly) have not been examined in the curlyfry mice.

Primers PCR Primer
curlyfry(F):5'- TTGCTGAAGGAAGTTGAAACTC -3'
curlyfry(R):5'- CAAAAGCAAAGCTCAATTAGTTGTCCC -3'

Sequencing Primer
curlyfry_seq(F):5'- AGCTGCCATTAACAAATATGAAAGC -3'
curlyfry_seq(R):5'- GTCCTGGAACTCACTTGTAGACCAG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsDanielle White, Lauren Prince, Jamie Russell, Emre Turer, and Bruce Beutler
List |< first << previous [record 98 of 511] next >> last >|