Phenotypic Mutation 'Allegra'

• Allele: Allegra
• Mutation Type: nonsense
• Chromosome: 12
• Coordinate: 113,234,994 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Ighe
• Gene Name: Immunoglobulin heavy constant epsilon
• Synonym(s): Gm900, LOC380792
• Chromosomal Location: 113,232,883-113,236,868 bp (-) (GRCm39)
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s):
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000118012; Gene: ENSMUSG00000087642; AA Change: Q389*

Domain	Start	End	E-Value	Type
IGc1	18	85	2.5e-6	SMART
IG_like	116	190	2.3e-5	SMART
IG_like	221	295	3e-4	SMART
low complexity region	310	323	N/A	INTRINSIC
IGc1	325	402	7.4e-35	SMART

• Predicted Effect: probably null
• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.049)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:44 PM by Anne Murray
• Record Created: 2015-10-15 12:38 PM by Bruce Beutler
• Record Posted: 2018-09-14
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Tao Yue, Bruce Beutler

Accession Number

MGI:2685746

Alleles Listed at MGI

All Mutations and Alleles(1) : Targeted(1)

Phenotypic Description

Figure 1. Allegra mice exhibited an increased ratio of OVA-specific IgE to total IgE. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Allegra mice exhibited reduced levels of total IgE. IgE levels were determined by ELISA. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Allegra phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3498, some of which showed an increase in the ratio of ovalbumin-specific IgE to total IgE after ovalbumin injection (Figure 1) caused by a decrease in total IgE levels (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the ratio of OVA-specific IgE to total IgE using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 46 mutations (X-axis) identified in the G1 male of pedigree R3498. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 46 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Ighe:  a C to T transition at base pair 113,271,374 (v38) on chromosome 12, or base pair 1,875 in the GenBank genomic region NC_000078 encoding Ighe.  The strongest association was found with an additive model of linkage to the normalized OVA-specific IgE to total IgE ratio, wherein five variant homozygotes and 20 heterozygous mice departed phenotypically from 14 homozygous reference mice with a P value of 2.694 x 10^-5 (Figure 3).  

The mutation corresponds to residue 1,167 in the cDNA sequence ENSMUST00000137336.2 within exon 4 of 4 total exons.

1152 TGGACACAGAGAAAACAGTTCACCTGCCAAGTG 384  -W--T--Q--R--K--Q--F--T--C--Q--V-

The mutated nucleotide is indicated in red.  The mutation results in substitution of glutamine (Q) to a premature stop codon (Q389*) in the Ighe protein.

Protein Prediction

Figure 4. Domain organization of sIgE. The Allegra mutation results in substitution of glutamine to a premature stop codon at position 389.

Figure 5. Structure of human IgE. Domains are colored as in Figure 4. The FcεRI receptor is shown in gray. Figure generated by UCSF Chimera and is based on PDB:2Y7Q.

The B cell receptor (BCR) consists of two functional components: an antigen binding component and a signaling component. The antigen-binding component is a membrane-bound form of immunoglobulin (mIg), which is a heterotetramer of two identical transmembrane-spanning heavy chains (alpha, delta, epsilon, gamma, or mu) and two associated identical light chains.

Ighe encodes immunoglobulin heavy constant epsilon (IgHε). Human IGHE produces three mRNAs that encode the membrane B cell receptor form and secreted proteins produced by plasma cells (2). Membrane-associated IgE has four heavy-chain constant domains (CH1 to CH4), an extracellular membrane-proximal domain, a transmembrane domain, and a cytoplasmic domain. The extracellular membrane-proximal domain contains inter-ε-chain disulfide bridges. The two exons (M1 and M2) that encode the extracellular membrane-proximal domain, transmembrane, and cytoplasmic domains are 3’ to the exons of the secreted form; the putative M1 exon is approximately 1.7 kb downstream of the CH4 exon, and the M2 exon is putatively 80 bases 3’ to the M1 exon (3).

Soluble IgHε has the C1 to CD4 domains only (Figure 4). The C2 domain of IgHε folds back, making contacts with the C3 and C4 domains [Figure 5; PDB:2Y7Q; (4;5)]. The C3 domains can adopt either closed or open conformations by rotating relative to the C4 domain. The C3 domains open up to form the FcεRI receptor-binding site (6). An asymmetrically bent IgE-Fc has one open C3 domain and another closed, lending to structural asymmetry when bound to the high-affinity α-chain of the FcεRI (sFcεRIα) receptor (7). The C3 domain also mediates binding of IgE to CD23. The C2 domain is predicted to regulate the dissociation rate between IgE and FcεRI (8).

Asn394 is glycosylated, facilitating formation of stable complexes with the FcεRI receptor.

Expression/Localization

Free IgE is primarily localized in the blood. Membrane IgE is expressed on the surface of B cells that have undergone class switching to IgE.

IgE synthesis is positively regulated by the co-ligation of membrane IgE and CD21 on B cells. IgE synthesis is negatively regulated by co-ligation of IgE and CD23 on the membrane by allergen-IgE complexes. Competition between CD21 and CD23 for membrane IgE leads to homeostasis [reviewed in (7)].

Background

Figure 6. IgE-associated signaling. IgE-bound antigen induces FcεRI crosslinking, which results in activation of Src family kinases Lyn and Fyn. Both promote downstream signaling through Syk and LAT. Fyn is important for phosphorylation of the adaptor known as Grb-2 associated binder-like protein 2 (Gab2) and activation of phosphoinositide 3-kinase (PI3K) activity in mast cells. Activated PI3K phosphorylates phosphatidylinositol- 4,5-biphosphate (PIP₂) to yield phosphatidylinositol-3,4,5-triphosphate (PIP₃). This process further propagates the signal through activation of phospholipase Cγ (PLCγ) that hydrolyses PIP₂ to inositol 1,4,5,-triphosphate (IP₃) and diacylglycerol (DAG). The binding of IP₃ to its receptor (IP₃R) triggers release of Ca²⁺ from endoplasmic reticulum. DAG and Ca²⁺ activate protein kinase C. DAG also recruits Ras guanyl nucleotide-releasing proteins (RasGRPs) for subsequent activation of Ras family proteins that stimulate PI3K. Enhanced concentration of Ca²⁺ as well as activated kinases and GTPases modulate cytoskeleton arrangements. Under FcεRI-driven signaling, Fyn activates STAT5, transcription factors that are required for mast cell survival (STAT5A) and cytokine production (STAT5B). IL-4-associated signaling activates STAT6, which translocates to the nucleus where it activates Ighe expression. IL-4R activation and CD40 ligation trigger the IgE isotype switch, B-cell proliferation, and expansion of the IgE-producing clone.

During B cell differentiation from immature to mature follicular or marginal zone cells, antibody isotypes serve as cell surface markers of B cell maturation, as distinct receptors for B cell activation, and as secreted mediators of antibody effector functions (9). During B cell maturation, immature B cells in the bone marrow only express the IgM isotype on their cell surface (10). Upon maturation into circulating follicular B cells, the B cells coexpress a second isotype, IgD. Mature follicular B cells display cell surface B cell receptors comprised of the same variable domain joined to either IgD or IgM constant regions (11). Upon B cell activation by antigens and helper T cells, the B cells undergo isotype switching and lose IgM and IgD, switching to express the same variable domain linked to IgG, IgA, or IgE constant region domains. Isotype switching involves DNA recombination of the Ig heavy chain locus, Igh, and subsequent deletion of Ighm and Ighd constant region exons and the reorganization of the Ighg, Ighe, or Igha constant region exons immediately 3’ to the VDJ_H variable exon. The VDJ_H exon is then spliced to IgG, IgE, or IgA constant region exons in the mRNA (12;13).

Membrane IgE mediates antigen uptake and presentation by B cells. Membrane IgE can also trigger B cell proliferation and differentiation in response to co-stimulatory signals. Membrane IgE signals through CD79 on B cells (Figure 6). A heterodimer of CD79a (Igα; see the record for crab) and CD79b (Igβ) constitutes the signaling component of the BCR (14-16). BCR signaling depends on the interactions of the cytoplasmic domains of Igα and Igβ with downstream signaling molecules, including Lyn (see the record for Lemon) and Fyn (but not Src) (17;18). Once phosphorylated on both tyrosines, the Igα/Igβ immunoreceptor tyrosine-based activation motifs (ITAMs) serve as docking sites for the adapter protein BLNK (see the record for busy) (19) and the two SH2 domains of Syk (see the record for poppy), which is then activated by SFK-dependent trans-phosphorylation (20-23). Syk-deficient B cells are deficient in downstream BCR signaling responses, but display normal SFK activation and Igα/Igβ phosphorylation, indicating that Syk is essential for transmitting signals from the BCR to distal signaling molecules (24). Syk phosphorylates a number of targets including BLNK, PLC-γ2 (see the record for queen), and PKCβ (see the record for Almonde). BLNK serves as a scaffold to bring together several important signaling molecules (25;26). In particular, phosphorylated BLNK provides docking sites for the tyrosine kinase Btk as well as PLC-γ2, resulting in phosphorylation and activation of PLC-γ2 by Btk (27;28). The Igα/Igβ heterodimer associates noncovalently with all mIg isotypes (IgM, IgD, IgG, IgA, and IgE) (29) (19).

IgE is recognized by the high-affinity FcεRI receptor on mast cells and basophils and the low-affinity CD23 (alternatively, FcεRII) on various antigen-presenting cells and antigen-activated B cells (30;31). IgE binding to FcεRI mediates allergic sensitization and the inflammatory responses. Interaction between IgE and FcεRI is essential for the immediate hypersensitivity response that is observed in many allergic reactions. IgE binding to CD23 mediates IgE synthesis (7). Upon IgE binding to the FcεRI receptor, the FcεRI receptor aggregates and the protein tyrosine kinase Lyn is activated. Lyn phosphorylates the immunoreceptor tyrosine-based activation motifs of the β- and γ-subunits of the receptor. Additional Lyn molecules and Syk are recruited to the phosphorylated ITAMs of the β- and γ-subunits, respectively. Syk subsequently phosphorylates several substrates, including LAT, SLP76, and Vav and activates several signaling pathways such as PI3K, PLCγ, RAS/ERK, JNK, p38, and AKT. Activation of these pathways leads to degranulation, synthesis and release of lipid mediators, histamine release, and the production and secretion of cytokines, chemokines, and growth factors by mast cells and basophils.

In humans, FcεRI is also expressed on dendritic cells and macrophages. Activation of FcεRI on DCs and macrophages promotes the internalization of IgE-bound antigens for processing and presentation at the cell surface. In addition FcεRI activation on DCs and macrophages stimulates the production of cytokines that promotes T helper 2-type immune responses (30). IgE can also bind IgG receptors FcγRII and FcγRIII on mast cells.

Aberrant serum levels of total or specific IgE are correlated with disease activity in chronic allergic diseases such as asthma, allergic rhinitis, and atopic dermatitis.

Primers

PCR Primer
Allegra_pcr_F: GCTTCCTGGTGTTACAACAGTG
Allegra_pcr_R: GGTATATGTGTTCCCACCACCAG

Sequencing Primer
Allegra_seq_F: TACAACAGTGAGCGGATGTCTGTC
Allegra_seq_R: TGTTCCCACCACCAGAGGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 12, - strand):

1   ggtatatgtg ttcccaccac cagaggagga gagcgaggac aaacgcacac tcacctgctt
61  gatccagaac ttcttccctg aggatatctc tgtgcagtgg ctggaggatg gcaaactgat
121 ctcaaacagc catcacagta ccacaacacc cctgaaatcc aatggctcca atcaaggctt
181 cttcatcttc agtcgcctag aggtcgccaa gacactctgg acacagagaa aacagttcac
241 ctgccaagtg atccatgagg cacttcagaa acccaggaaa ctggagaaaa caatatccac
301 gagccttggt aacacctccc tccatccctc ctaggcctcc atgtagctgt ggtggggaag
361 gtggatgaca gacatccgct cactgttgta acaccaggaa gc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Zhang, K., Saxon, A., and Max, E. E. (1992) Two Unusual Forms of Human Immunoglobulin E Encoded by Alternative RNA Splicing of Epsilon Heavy Chain Membrane Exons. J Exp Med. 176, 233-243.

  3. Ishida, N., Ueda, S., Hayashida, H., Miyata, T., and Honjo, T. (1982) The Nucleotide Sequence of the Mouse Immunoglobulin Epsilon Gene: Comparison with the Human Epsilon Gene Sequence. EMBO J. 1, 1117-1123.

  4. Wan, T., Beavil, R. L., Fabiane, S. M., Beavil, A. J., Sohi, M. K., Keown, M., Young, R. J., Henry, A. J., Owens, R. J., Gould, H. J., and Sutton, B. J. (2002) The Crystal Structure of IgE Fc Reveals an Asymmetrically Bent Conformation. Nat Immunol. 3, 681-686.

  5. Beavil, A. J., Young, R. J., Sutton, B. J., and Perkins, S. J. (1995) Bent Domain Structure of Recombinant Human IgE-Fc in Solution by X-Ray and Neutron Scattering in Conjunction with an Automated Curve Fitting Procedure. Biochemistry. 34, 14449-14461.

  6. Garman, S. C., Wurzburg, B. A., Tarchevskaya, S. S., Kinet, J. P., and Jardetzky, T. S. (2000) Structure of the Fc Fragment of Human IgE Bound to its High-Affinity Receptor Fc epsilonRI Alpha. Nature. 406, 259-266.

  7. Gould, H. J., and Sutton, B. J. (2008) IgE in Allergy and Asthma Today. Nat Rev Immunol. 8, 205-217.

  8. McDonnell, J. M., Calvert, R., Beavil, R. L., Beavil, A. J., Henry, A. J., Sutton, B. J., Gould, H. J., and Cowburn, D. (2001) The Structure of the IgE Cepsilon2 Domain and its Role in Stabilizing the Complex with its High-Affinity Receptor FcepsilonRIalpha. Nat Struct Biol. 8, 437-441.

  9. Hardy, R. R., Kincade, P. W., and Dorshkind, K. (2007) The Protean Nature of Cells in the B Lymphocyte Lineage. Immunity. 26, 703-714.

  10. Lawton, A. R.,3rd, Asofsky, R., Hylton, M. B., and Cooper, M. D. (1972) Suppression of Immunoglobulin Class Synthesis in Mice. I. Effects of Treatment with Antibody to -Chain. J Exp Med. 135, 277-297.

  11. Vitetta, E. S., Melcher, U., McWilliams, M., Lamm, M. E., Phillips-Quagliata, J. M., and Uhr, J. W. (1975) Cell Surface Immunoglobulin. XI. the Appearance of an IgD-Like Molecule on Murine Lymphoid Cells during Ontogeny. J Exp Med. 141, 206-215.

  12. Honjo, T., and Kataoka, T. (1978) Organization of Immunoglobulin Heavy Chain Genes and Allelic Deletion Model. Proc Natl Acad Sci U S A. 75, 2140-2144.

  13. Cory, S., Jackson, J., and Adams, J. M. (1980) Deletions in the Constant Region Locus can Account for Switches in Immunoglobulin Heavy Chain Expression. Nature. 285, 450-456.

  14. Campbell, K. S., Hager, E. J., Friedrich, R. J., and Cambier, J. C. (1991) IgM Antigen Receptor Complex Contains Phosphoprotein Products of B29 and Mb-1 Genes. Proc Natl Acad Sci U S A. 88, 3982-3986.

  15. Hombach, J., Tsubata, T., Leclercq, L., Stappert, H., and Reth, M. (1990) Molecular Components of the B-Cell Antigen Receptor Complex of the IgM Class. Nature. 343, 760-762.

  16. Campbell, K. S., and Cambier, J. C. (1990) B Lymphocyte Antigen Receptors (mIg) are Non-Covalently Associated with a Disulfide Linked, Inducibly Phosphorylated Glycoprotein Complex. EMBO J. 9, 441-448.

  17. Clark, M. R., Campbell, K. S., Kazlauskas, A., Johnson, S. A., Hertz, M., Potter, T. A., Pleiman, C., and Cambier, J. C. (1992) The B Cell Antigen Receptor Complex: Association of Ig-Alpha and Ig-Beta with Distinct Cytoplasmic Effectors. Science. 258, 123-126.

  18. Pleiman, C. M., Abrams, C., Gauen, L. T., Bedzyk, W., Jongstra, J., Shaw, A. S., and Cambier, J. C. (1994) Distinct p53/56lyn and p59fyn Domains Associate with Nonphosphorylated and Phosphorylated Ig-Alpha. Proc Natl Acad Sci U S A. 91, 4268-4272.

  19. Kabak, S., Skaggs, B. J., Gold, M. R., Affolter, M., West, K. L., Foster, M. S., Siemasko, K., Chan, A. C., Aebersold, R., and Clark, M. R. (2002) The Direct Recruitment of BLNK to Immunoglobulin Alpha Couples the B-Cell Antigen Receptor to Distal Signaling Pathways. Mol Cell Biol. 22, 2524-2535.

  20. Chen, T., Repetto, B., Chizzonite, R., Pullar, C., Burghardt, C., Dharm, E., Zhao, Z., Carroll, R., Nunes, P., Basu, M., Danho, W., Visnick, M., Kochan, J., Waugh, D., and Gilfillan, A. M. (1996) Interaction of Phosphorylated FcepsilonRIgamma Immunoglobulin Receptor Tyrosine Activation Motif-Based Peptides with Dual and Single SH2 Domains of p72syk. Assessment of Binding Parameters and Real Time Binding Kinetics. J Biol Chem. 271, 25308-25315.

  21. Kurosaki, T., Johnson, S. A., Pao, L., Sada, K., Yamamura, H., and Cambier, J. C. (1995) Role of the Syk Autophosphorylation Site and SH2 Domains in B Cell Antigen Receptor Signaling. J Exp Med. 182, 1815-1823.

  22. Johnson, S. A., Pleiman, C. M., Pao, L., Schneringer, J., Hippen, K., and Cambier, J. C. (1995) Phosphorylated Immunoreceptor Signaling Motifs (ITAMs) Exhibit Unique Abilities to Bind and Activate Lyn and Syk Tyrosine Kinases. J Immunol. 155, 4596-4603.

  23. Rowley, R. B., Burkhardt, A. L., Chao, H. G., Matsueda, G. R., and Bolen, J. B. (1995) Syk Protein-Tyrosine Kinase is Regulated by Tyrosine-Phosphorylated Ig alpha/Ig Beta Immunoreceptor Tyrosine Activation Motif Binding and Autophosphorylation. J Biol Chem. 270, 11590-11594.

  24. Takata, M., Sabe, H., Hata, A., Inazu, T., Homma, Y., Nukada, T., Yamamura, H., and Kurosaki, T. (1994) Tyrosine Kinases Lyn and Syk Regulate B Cell Receptor-Coupled Ca2+ Mobilization through Distinct Pathways. EMBO J. 13, 1341-1349.

  25. Chiu, C. W., Dalton, M., Ishiai, M., Kurosaki, T., and Chan, A. C. (2002) BLNK: Molecular Scaffolding through 'Cis'-Mediated Organization of Signaling Proteins. EMBO J. 21, 6461-6472.

  26. Wienands, J., Schweikert, J., Wollscheid, B., Jumaa, H., Nielsen, P. J., and Reth, M. (1998) SLP-65: A New Signaling Component in B Lymphocytes which Requires Expression of the Antigen Receptor for Phosphorylation. J Exp Med. 188, 791-795.

  27. Baba, Y., Hashimoto, S., Matsushita, M., Watanabe, D., Kishimoto, T., Kurosaki, T., and Tsukada, S. (2001) BLNK Mediates Syk-Dependent Btk Activation. Proc Natl Acad Sci U S A. 98, 2582-2586.

  28. Ishiai, M., Kurosaki, M., Pappu, R., Okawa, K., Ronko, I., Fu, C., Shibata, M., Iwamatsu, A., Chan, A. C., and Kurosaki, T. (1999) BLNK Required for Coupling Syk to PLC Gamma 2 and Rac1-JNK in B Cells. Immunity. 10, 117-125.

  29. Venkitaraman, A. R., Williams, G. T., Dariavach, P., and Neuberger, M. S. (1991) The B-Cell Antigen Receptor of the Five Immunoglobulin Classes. Nature. 352, 777-781.

  30. Kraft, S., and Kinet, J. P. (2007) New Developments in FcepsilonRI Regulation, Function and Inhibition. Nat Rev Immunol. 7, 365-378.

  31. Acharya, M., Borland, G., Edkins, A. L., Maclellan, L. M., Matheson, J., Ozanne, B. W., and Cushley, W. (2010) CD23/FcepsilonRII: Molecular Multi-Tasking. Clin Exp Immunol. 162, 12-23.